Incidental Mutation 'R7445:Pdxk'
ID 577239
Institutional Source Beutler Lab
Gene Symbol Pdxk
Ensembl Gene ENSMUSG00000032788
Gene Name pyridoxal (pyridoxine, vitamin B6) kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 78436744-78464975 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78447967 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 131 (D131G)
Ref Sequence ENSEMBL: ENSMUSP00000038540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041616]
AlphaFold Q8K183
Predicted Effect probably benign
Transcript: ENSMUST00000041616
AA Change: D131G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038540
Gene: ENSMUSG00000032788
AA Change: D131G

DomainStartEndE-ValueType
Pfam:Phos_pyr_kin 69 285 1.4e-18 PFAM
Pfam:PfkB 95 277 1.3e-9 PFAM
Meta Mutation Damage Score 0.1246 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Pdxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Pdxk APN 10 78451485 missense probably damaging 1.00
R1434:Pdxk UTSW 10 78440811 missense probably benign 0.01
R1572:Pdxk UTSW 10 78447980 missense probably damaging 1.00
R1719:Pdxk UTSW 10 78443896 missense probably benign
R1970:Pdxk UTSW 10 78441154 missense probably damaging 1.00
R2962:Pdxk UTSW 10 78443833 missense probably damaging 1.00
R4094:Pdxk UTSW 10 78464810 missense probably damaging 1.00
R4095:Pdxk UTSW 10 78464810 missense probably damaging 1.00
R4613:Pdxk UTSW 10 78447919 missense probably damaging 0.99
R4686:Pdxk UTSW 10 78447003 splice site probably null
R4783:Pdxk UTSW 10 78464792 missense possibly damaging 0.72
R4980:Pdxk UTSW 10 78451484 missense probably damaging 1.00
R5076:Pdxk UTSW 10 78450307 missense probably benign
R5847:Pdxk UTSW 10 78445038 missense probably benign
R6145:Pdxk UTSW 10 78443791 missense probably benign 0.44
R7109:Pdxk UTSW 10 78446976 missense probably damaging 1.00
R7399:Pdxk UTSW 10 78440863 missense probably benign 0.00
R7629:Pdxk UTSW 10 78445006 missense probably benign
R7700:Pdxk UTSW 10 78443930 splice site probably null
R7936:Pdxk UTSW 10 78441178 missense possibly damaging 0.93
R8178:Pdxk UTSW 10 78453504 missense probably damaging 0.99
R8780:Pdxk UTSW 10 78447952 missense probably benign 0.04
R8783:Pdxk UTSW 10 78451505 missense probably benign 0.06
R8964:Pdxk UTSW 10 78447937 missense probably benign 0.17
Z1176:Pdxk UTSW 10 78441188 missense probably damaging 1.00
Z1177:Pdxk UTSW 10 78443905 missense probably benign 0.33
Z1189:Pdxk UTSW 10 78445061 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GTACAGGCCAGGCTTTCTAAGG -3'
(R):5'- TTCTAGTGAGCTGAGGTCCTGC -3'

Sequencing Primer
(F):5'- AGGCTTTCTAAGGGCCACC -3'
(R):5'- CTGAGGTCCTGCCCCAG -3'
Posted On 2019-10-07