Incidental Mutation 'R7445:Heatr1'
ID577248
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7445 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12431038 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 1632 (W1632L)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059270
AA Change: W1632L

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: W1632L

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.2091 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
R7669:Heatr1 UTSW 13 12411262 missense probably benign 0.33
R7672:Heatr1 UTSW 13 12438664 missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12417641 missense probably benign 0.03
RF011:Heatr1 UTSW 13 12407544 missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12399008 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGTCTTACAGAGTTGAGTTCTCC -3'
(R):5'- TGATCCATACAGTGTCCCGG -3'

Sequencing Primer
(F):5'- CTTACAGAGTTGAGTTCTCCTTTTTG -3'
(R):5'- CTTAGCACATCTCTAGCATGAGGAG -3'
Posted On2019-10-07