Incidental Mutation 'R7445:Klra10'
ID 577223
Institutional Source Beutler Lab
Gene Symbol Klra10
Ensembl Gene ENSMUSG00000072718
Gene Name killer cell lectin-like receptor subfamily A, member 10
Synonyms Ly49i2, Ly49J
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 130269194-130281928 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130275856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 152 (T152A)
Ref Sequence ENSEMBL: ENSMUSP00000107651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112020]
AlphaFold Q9R1G6
Predicted Effect probably benign
Transcript: ENSMUST00000112020
AA Change: T152A

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107651
Gene: ENSMUSG00000072718
AA Change: T152A

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 2e-9 BLAST
CLECT 143 258 6.43e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Klra10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Klra10 APN 6 130272717 missense probably damaging 1.00
IGL02060:Klra10 APN 6 130272725 missense probably damaging 0.99
IGL02249:Klra10 APN 6 130279404 missense probably benign 0.07
IGL02681:Klra10 APN 6 130279419 missense probably damaging 0.98
IGL02684:Klra10 APN 6 130281882 missense possibly damaging 0.85
FR4342:Klra10 UTSW 6 130272747 missense probably benign 0.01
R0324:Klra10 UTSW 6 130272650 splice site probably null
R1072:Klra10 UTSW 6 130281848 missense probably benign 0.11
R1466:Klra10 UTSW 6 130279315 missense probably damaging 1.00
R1466:Klra10 UTSW 6 130279431 missense probably damaging 0.98
R1466:Klra10 UTSW 6 130279315 missense probably damaging 1.00
R1466:Klra10 UTSW 6 130279431 missense probably damaging 0.98
R2125:Klra10 UTSW 6 130279278 missense probably damaging 0.98
R2266:Klra10 UTSW 6 130269301 missense probably benign 0.13
R2427:Klra10 UTSW 6 130279335 missense probably benign 0.00
R4260:Klra10 UTSW 6 130272681 missense probably damaging 1.00
R4495:Klra10 UTSW 6 130279348 missense probably benign 0.00
R5897:Klra10 UTSW 6 130281829 nonsense probably null
R6123:Klra10 UTSW 6 130279376 missense probably benign 0.04
R6221:Klra10 UTSW 6 130269272 missense probably benign
R6478:Klra10 UTSW 6 130272544 splice site probably null
R6520:Klra10 UTSW 6 130275792 missense probably benign 0.03
R6551:Klra10 UTSW 6 130275755 missense probably benign 0.36
R7453:Klra10 UTSW 6 130280364 missense probably damaging 0.98
R7744:Klra10 UTSW 6 130272761 critical splice acceptor site probably null
R8079:Klra10 UTSW 6 130275775 missense probably benign
R8320:Klra10 UTSW 6 130269248 missense probably damaging 1.00
R8963:Klra10 UTSW 6 130272654 critical splice donor site probably null
R9419:Klra10 UTSW 6 130279472 missense probably damaging 1.00
RF060:Klra10 UTSW 6 130275821 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCCCACAGTTCACATTACAGG -3'
(R):5'- GGGAGTTTGGGCATTATAGAATTTCAC -3'

Sequencing Primer
(F):5'- GTATCTGGTACCACATTATTCAGGG -3'
(R):5'- TGGGCATTATAGAATTTCACTTTCTG -3'
Posted On 2019-10-07