Incidental Mutation 'R7603:Mfsd14a'
ID588107
Institutional Source Beutler Lab
Gene Symbol Mfsd14a
Ensembl Gene ENSMUSG00000089911
Gene Namemajor facilitator superfamily domain containing 14A
SynonymsHiat1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116631164-116662677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116633883 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 369 (V369F)
Ref Sequence ENSEMBL: ENSMUSP00000029570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029570] [ENSMUST00000029571] [ENSMUST00000197335] [ENSMUST00000198311]
Predicted Effect probably damaging
Transcript: ENSMUST00000029570
AA Change: V369F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029570
Gene: ENSMUSG00000089911
AA Change: V369F

DomainStartEndE-ValueType
Pfam:MFS_1 40 388 3.4e-33 PFAM
Pfam:MFS_2 182 407 3.6e-10 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029571
SMART Domains Protein: ENSMUSP00000029571
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:SAS-6_N 44 141 1.7e-29 PFAM
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197335
SMART Domains Protein: ENSMUSP00000143123
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
PDB:2Y3W|C 7 136 3e-48 PDB
low complexity region 188 200 N/A INTRINSIC
coiled coil region 380 436 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198311
SMART Domains Protein: ENSMUSP00000143233
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 9e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with oligozoospermia, globozoospermia, and defects in spermiogenesis and acrosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Mfsd14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Mfsd14a APN 3 116641855 missense probably benign 0.16
IGL03197:Mfsd14a APN 3 116636363 missense probably benign 0.01
R1166:Mfsd14a UTSW 3 116633894 unclassified probably benign
R1796:Mfsd14a UTSW 3 116634947 missense probably damaging 1.00
R1842:Mfsd14a UTSW 3 116632408 missense possibly damaging 0.93
R1871:Mfsd14a UTSW 3 116641320 missense probably benign 0.11
R2155:Mfsd14a UTSW 3 116647830 missense probably damaging 1.00
R2176:Mfsd14a UTSW 3 116632393 missense probably benign 0.00
R3078:Mfsd14a UTSW 3 116647917 splice site probably benign
R4451:Mfsd14a UTSW 3 116662478 start codon destroyed probably null 0.77
R4794:Mfsd14a UTSW 3 116645506 intron probably benign
R5197:Mfsd14a UTSW 3 116648501 intron probably benign
R5868:Mfsd14a UTSW 3 116633750 missense probably benign
R7098:Mfsd14a UTSW 3 116641712 missense probably benign 0.22
R7836:Mfsd14a UTSW 3 116648551 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTAAGGCCTATTCATGCTAGAAAG -3'
(R):5'- CTTATGTTATGCCTGGGCCTGC -3'

Sequencing Primer
(F):5'- GGCCTATTCATGCTAGAAAGTTTTAC -3'
(R):5'- ATGCCTGGGCCTGCATTTG -3'
Posted On2019-10-24