Incidental Mutation 'R7603:Nek9'
ID588129
Institutional Source Beutler Lab
Gene Symbol Nek9
Ensembl Gene ENSMUSG00000034290
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 9
SynonymsC130021H08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7603 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85299514-85339362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85303514 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 929 (F929L)
Ref Sequence ENSEMBL: ENSMUSP00000049056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040992] [ENSMUST00000059341]
Predicted Effect probably benign
Transcript: ENSMUST00000040992
AA Change: F929L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290
AA Change: F929L

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059341
SMART Domains Protein: ENSMUSP00000051664
Gene: ENSMUSG00000045064

DomainStartEndE-ValueType
low complexity region 93 106 N/A INTRINSIC
coiled coil region 207 254 N/A INTRINSIC
Pfam:zf-C2HC_2 378 402 3.6e-10 PFAM
low complexity region 433 444 N/A INTRINSIC
Pfam:zf-C2HC_2 489 513 3.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein is activated in mitosis and, in turn, activates other family members during mitosis. This protein also mediates cellular processes that are essential for interphase progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Nek9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Nek9 APN 12 85314587 missense probably benign 0.23
IGL01595:Nek9 APN 12 85314420 missense probably damaging 1.00
IGL01603:Nek9 APN 12 85305605 missense probably damaging 1.00
IGL01893:Nek9 APN 12 85336400 missense probably damaging 1.00
IGL02017:Nek9 APN 12 85329923 missense probably damaging 1.00
IGL02197:Nek9 APN 12 85307930 missense probably null
IGL02207:Nek9 APN 12 85303483 nonsense probably null
IGL02749:Nek9 APN 12 85305507 missense probably benign 0.02
IGL02756:Nek9 APN 12 85311336 critical splice donor site probably null
IGL03343:Nek9 APN 12 85303609 missense probably damaging 1.00
Rose_colored UTSW 12 85303537 missense probably damaging 1.00
R0048:Nek9 UTSW 12 85301899 missense probably benign 0.17
R0331:Nek9 UTSW 12 85327375 splice site probably benign
R0499:Nek9 UTSW 12 85301883 missense probably benign 0.09
R1484:Nek9 UTSW 12 85301848 missense probably damaging 1.00
R1760:Nek9 UTSW 12 85305590 missense possibly damaging 0.71
R1760:Nek9 UTSW 12 85310410 missense probably benign 0.00
R1883:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1884:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1999:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2046:Nek9 UTSW 12 85320707 splice site probably benign
R2096:Nek9 UTSW 12 85314548 missense probably benign 0.00
R2150:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2368:Nek9 UTSW 12 85329887 missense possibly damaging 0.89
R2570:Nek9 UTSW 12 85332546 nonsense probably null
R4381:Nek9 UTSW 12 85329858 missense probably damaging 1.00
R4570:Nek9 UTSW 12 85320734 missense probably damaging 1.00
R4661:Nek9 UTSW 12 85320892 missense possibly damaging 0.78
R4669:Nek9 UTSW 12 85314204 missense probably benign 0.00
R4993:Nek9 UTSW 12 85310420 missense probably damaging 1.00
R5071:Nek9 UTSW 12 85327459 missense possibly damaging 0.70
R5090:Nek9 UTSW 12 85329842 critical splice donor site probably null
R5248:Nek9 UTSW 12 85308977 missense probably damaging 1.00
R5521:Nek9 UTSW 12 85327445 missense probably benign 0.09
R5734:Nek9 UTSW 12 85303515 missense probably benign
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6269:Nek9 UTSW 12 85332329 intron probably null
R6353:Nek9 UTSW 12 85301829 missense probably damaging 0.96
R6406:Nek9 UTSW 12 85339172 missense probably damaging 0.97
R6744:Nek9 UTSW 12 85329929 missense probably benign 0.09
R6922:Nek9 UTSW 12 85303537 missense probably damaging 1.00
R7686:Nek9 UTSW 12 85303659 missense probably benign 0.01
R7905:Nek9 UTSW 12 85305596 missense probably damaging 1.00
R7988:Nek9 UTSW 12 85305596 missense probably damaging 1.00
X0052:Nek9 UTSW 12 85322027 critical splice donor site probably null
Z1177:Nek9 UTSW 12 85334045 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCCCATCATTGAGAGACAGG -3'
(R):5'- GCTGGTTAACGGAAACTGTTTG -3'

Sequencing Primer
(F):5'- GGAGTCACAAAGAGCTAAGTCTAC -3'
(R):5'- ATGGCAGATCCTGTGCATTATC -3'
Posted On2019-10-24