Incidental Mutation 'R7607:Pde1c'
ID588362
Institutional Source Beutler Lab
Gene Symbol Pde1c
Ensembl Gene ENSMUSG00000004347
Gene Namephosphodiesterase 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7607 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location56069804-56569103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56150628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 391 (T391A)
Ref Sequence ENSEMBL: ENSMUSP00000046601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044505] [ENSMUST00000114327] [ENSMUST00000164037] [ENSMUST00000164752] [ENSMUST00000166102] [ENSMUST00000166890] [ENSMUST00000168944] [ENSMUST00000170774] [ENSMUST00000203372]
Predicted Effect probably damaging
Transcript: ENSMUST00000044505
AA Change: T391A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046601
Gene: ENSMUSG00000004347
AA Change: T391A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3.8e-34 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 681 1e-123 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114327
AA Change: T391A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109966
Gene: ENSMUSG00000004347
AA Change: T391A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164037
AA Change: T382A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130139
Gene: ENSMUSG00000004347
AA Change: T382A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 8e-32 PFAM
HDc 216 381 1.02e-5 SMART
Blast:HDc 393 618 1e-102 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164752
AA Change: T391A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129185
Gene: ENSMUSG00000004347
AA Change: T391A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166102
AA Change: T391A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131350
Gene: ENSMUSG00000004347
AA Change: T391A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166890
AA Change: T363A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131892
Gene: ENSMUSG00000004347
AA Change: T363A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 54 114 3.5e-31 PFAM
HDc 197 362 1.02e-5 SMART
Blast:HDc 374 599 1e-102 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000168944
AA Change: T391A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128364
Gene: ENSMUSG00000004347
AA Change: T391A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000170774
AA Change: T354A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133170
Gene: ENSMUSG00000004347
AA Change: T354A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 45 105 3.6e-31 PFAM
HDc 188 353 1.02e-5 SMART
Blast:HDc 365 613 1e-110 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000203372
AA Change: T451A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145508
Gene: ENSMUSG00000004347
AA Change: T451A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 142 202 3.1e-31 PFAM
HDc 285 450 5.8e-8 SMART
Blast:HDc 462 741 1e-122 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]
PHENOTYPE: Olfactory sensory nerves from homozygous null mice have significantly reduced action potentials in response to odor with slower onset kinetics and a faster response termination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Pde1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pde1c APN 6 56173674 missense probably damaging 1.00
IGL02316:Pde1c APN 6 56151351 missense possibly damaging 0.77
IGL02751:Pde1c APN 6 56181688 missense probably damaging 1.00
IGL02801:Pde1c APN 6 56173666 missense probably damaging 1.00
IGL02975:Pde1c APN 6 56158936 missense probably damaging 1.00
IGL03357:Pde1c APN 6 56180093 missense probably damaging 1.00
R0523:Pde1c UTSW 6 56174941 missense probably damaging 1.00
R0717:Pde1c UTSW 6 56123012 missense probably damaging 0.98
R0973:Pde1c UTSW 6 56361815 missense probably benign 0.00
R1344:Pde1c UTSW 6 56361767 missense probably benign 0.08
R1521:Pde1c UTSW 6 56173607 missense possibly damaging 0.91
R1818:Pde1c UTSW 6 56126892 nonsense probably null
R2004:Pde1c UTSW 6 56159011 missense probably damaging 1.00
R2026:Pde1c UTSW 6 56180190 missense probably damaging 1.00
R4380:Pde1c UTSW 6 56072278 missense probably null 0.02
R4729:Pde1c UTSW 6 56072209 missense probably damaging 1.00
R4847:Pde1c UTSW 6 56123034 missense possibly damaging 0.52
R4993:Pde1c UTSW 6 56150624 missense probably damaging 0.98
R5666:Pde1c UTSW 6 56126857 critical splice donor site probably null
R6005:Pde1c UTSW 6 56479202 splice site probably null
R6636:Pde1c UTSW 6 56180102 missense probably damaging 1.00
R6701:Pde1c UTSW 6 56181700 missense probably damaging 1.00
R6990:Pde1c UTSW 6 56442035 missense possibly damaging 0.92
R7622:Pde1c UTSW 6 56126925 missense probably damaging 1.00
R8260:Pde1c UTSW 6 56137419 missense probably benign
R8416:Pde1c UTSW 6 56151291 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCACCAGGAAACACTTTTCTTC -3'
(R):5'- TTTCCTCAACTCGGTGCTAG -3'

Sequencing Primer
(F):5'- GGAAACACTTTTCTTCATCTAAGCAG -3'
(R):5'- AACTCGGTGCTAGTTGAGTTTGAG -3'
Posted On2019-10-24