Incidental Mutation 'R7607:Mtmr12'
ID 588399
Institutional Source Beutler Lab
Gene Symbol Mtmr12
Ensembl Gene ENSMUSG00000039458
Gene Name myotubularin related protein 12
Synonyms Pip3ap, C730015A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 12205028-12274496 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 12257708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 291 (Q291*)
Ref Sequence ENSEMBL: ENSMUSP00000041227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038172] [ENSMUST00000071993] [ENSMUST00000174160] [ENSMUST00000174418]
AlphaFold Q80TA6
Predicted Effect probably null
Transcript: ENSMUST00000038172
AA Change: Q291*
SMART Domains Protein: ENSMUSP00000041227
Gene: ENSMUSG00000039458
AA Change: Q291*

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 7.6e-55 PFAM
Pfam:3-PAP 559 687 3.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071993
SMART Domains Protein: ENSMUSP00000071883
Gene: ENSMUSG00000039458

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Myotub-related 17 193 7.8e-53 PFAM
Pfam:3-PAP 249 380 8.8e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174160
AA Change: Q291*
SMART Domains Protein: ENSMUSP00000134293
Gene: ENSMUSG00000039458
AA Change: Q291*

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 3.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174418
SMART Domains Protein: ENSMUSP00000133285
Gene: ENSMUSG00000039458

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositide 3-kinase-derived membrane-anchored phosphatidylinositides, such as phosphatidylinositol 3-phosphate (PtdIns(3)P), regulate diverse cellular processes. The protein encoded by this gene functions as an adaptor subunit in a complex with an active PtdIns(3)P 3-phosphatase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Mtmr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Mtmr12 APN 15 12269959 missense probably damaging 1.00
IGL02158:Mtmr12 APN 15 12237930 missense probably damaging 1.00
pius UTSW 15 12245011 missense probably damaging 1.00
R0281:Mtmr12 UTSW 15 12257706 nonsense probably null
R1739:Mtmr12 UTSW 15 12245019 missense probably benign 0.06
R1876:Mtmr12 UTSW 15 12257630 missense probably damaging 1.00
R2284:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R4301:Mtmr12 UTSW 15 12236020 missense possibly damaging 0.95
R4424:Mtmr12 UTSW 15 12230314 missense probably damaging 0.98
R4617:Mtmr12 UTSW 15 12270046 missense probably damaging 1.00
R5418:Mtmr12 UTSW 15 12269959 missense probably damaging 1.00
R6316:Mtmr12 UTSW 15 12236113 missense probably null 0.31
R6857:Mtmr12 UTSW 15 12263832 missense probably damaging 1.00
R7068:Mtmr12 UTSW 15 12257670 missense probably null 0.08
R7511:Mtmr12 UTSW 15 12265595 missense possibly damaging 0.94
R7515:Mtmr12 UTSW 15 12269951 missense probably damaging 1.00
R7709:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R8217:Mtmr12 UTSW 15 12259640 missense possibly damaging 0.89
R8257:Mtmr12 UTSW 15 12259598 missense possibly damaging 0.89
R8398:Mtmr12 UTSW 15 12265609 missense probably damaging 1.00
R8778:Mtmr12 UTSW 15 12269920 missense probably benign 0.00
RF013:Mtmr12 UTSW 15 12261898 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCCTGCTTGACCATAAATGC -3'
(R):5'- GGCTCTTAACATTACAACACCATG -3'

Sequencing Primer
(F):5'- CTGCTTGACCATAAATGCTAAACTC -3'
(R):5'- CACTCCCTGCAAGAGAATTAGAGTG -3'
Posted On 2019-10-24