Incidental Mutation 'R0242:Hc'
ID59523
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 038480-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R0242 (G1)
Quality Score211
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 35036154 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 probably benign Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 F480L probably benign Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 T1324M probably benign Het
Dlgap2 A G 8: 14,727,562 D268G probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Myo5b A G 18: 74,661,716 H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thegl G T 5: 77,016,305 E52* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 A451T possibly damaging Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 splice site probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7388:Hc UTSW 2 34984847 splice site probably null
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
R7853:Hc UTSW 2 35010033 missense probably damaging 1.00
R7877:Hc UTSW 2 34997399 nonsense probably null
R8329:Hc UTSW 2 35012898 splice site probably null
R8375:Hc UTSW 2 34983719 missense probably benign 0.32
R8477:Hc UTSW 2 34989170 missense probably damaging 1.00
R8810:Hc UTSW 2 35019523 missense probably benign 0.06
R8888:Hc UTSW 2 35000849 missense probably benign 0.00
R8895:Hc UTSW 2 35000849 missense probably benign 0.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Z1176:Hc UTSW 2 35006273 critical splice acceptor site probably null
Z1177:Hc UTSW 2 35013610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACCTCAAACTTTAGCACCGTC -3'
(R):5'- GAAGGCCACTGTCCTCTTTCCAAC -3'

Sequencing Primer
(F):5'- CACCGTCACATTTGATGGGAG -3'
(R):5'- GGAACACTAACTCAGAGTTTGCTG -3'
Posted On2013-07-11