Incidental Mutation 'R7825:Nav1'
ID602109
Institutional Source Beutler Lab
Gene Symbol Nav1
Ensembl Gene ENSMUSG00000009418
Gene Nameneuron navigator 1
Synonymssteerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R7825 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location135434580-135607295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135450044 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1689 (V1689D)
Ref Sequence ENSEMBL: ENSMUSP00000067241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]
Predicted Effect probably damaging
Transcript: ENSMUST00000040599
AA Change: V1689D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: V1689D

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067414
AA Change: V1689D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: V1689D

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190298
AA Change: V1629D
SMART Domains Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: V1629D

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1013 1048 N/A INTRINSIC
low complexity region 1122 1153 N/A INTRINSIC
low complexity region 1200 1221 N/A INTRINSIC
low complexity region 1236 1244 N/A INTRINSIC
coiled coil region 1268 1300 N/A INTRINSIC
AAA 1488 1642 3.16e-5 SMART
Meta Mutation Damage Score 0.4405 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Clasp1 T C 1: 118,545,393 V3A probably benign Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Eif3e A C 15: 43,266,271 probably null Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Nav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nav1 APN 1 135450630 missense probably damaging 1.00
IGL01455:Nav1 APN 1 135469635 missense probably benign 0.44
IGL01650:Nav1 APN 1 135454760 missense probably damaging 1.00
IGL01872:Nav1 APN 1 135454076 missense probably damaging 1.00
IGL01967:Nav1 APN 1 135537245 missense probably damaging 1.00
IGL02167:Nav1 APN 1 135470961 missense probably damaging 1.00
IGL02278:Nav1 APN 1 135463714 splice site probably benign
IGL02343:Nav1 APN 1 135454752 nonsense probably null
IGL02378:Nav1 APN 1 135469978 missense probably benign 0.02
IGL02554:Nav1 APN 1 135584913 synonymous silent
IGL03148:Nav1 APN 1 135470024 missense possibly damaging 0.94
IGL03286:Nav1 APN 1 135454536 missense probably benign
IGL03372:Nav1 APN 1 135450903 missense probably damaging 0.99
PIT4802001:Nav1 UTSW 1 135452933 missense unknown
R0388:Nav1 UTSW 1 135448917 splice site probably benign
R0390:Nav1 UTSW 1 135449966 missense possibly damaging 0.80
R0395:Nav1 UTSW 1 135532621 nonsense probably null
R0395:Nav1 UTSW 1 135532623 missense probably damaging 0.97
R0416:Nav1 UTSW 1 135471126 missense possibly damaging 0.73
R0463:Nav1 UTSW 1 135452207 missense possibly damaging 0.76
R0538:Nav1 UTSW 1 135464692 splice site probably benign
R0594:Nav1 UTSW 1 135467643 missense possibly damaging 0.74
R0696:Nav1 UTSW 1 135532614 missense probably damaging 0.99
R0699:Nav1 UTSW 1 135452949 missense probably benign 0.00
R0759:Nav1 UTSW 1 135455260 missense possibly damaging 0.73
R1164:Nav1 UTSW 1 135472410 missense probably benign
R1169:Nav1 UTSW 1 135455205 missense probably damaging 1.00
R1401:Nav1 UTSW 1 135460425 missense probably benign 0.20
R1421:Nav1 UTSW 1 135585010 missense probably damaging 1.00
R1642:Nav1 UTSW 1 135452272 missense probably damaging 1.00
R1705:Nav1 UTSW 1 135584599 missense probably damaging 1.00
R1713:Nav1 UTSW 1 135595234 intron probably benign
R1728:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1729:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1730:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1739:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1740:Nav1 UTSW 1 135458389 critical splice donor site probably null
R1762:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1783:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1784:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1785:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1895:Nav1 UTSW 1 135458658 missense probably damaging 1.00
R1896:Nav1 UTSW 1 135460737 missense probably benign 0.00
R1901:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1902:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1925:Nav1 UTSW 1 135607229 utr 5 prime probably benign
R1939:Nav1 UTSW 1 135465898 missense probably damaging 1.00
R1971:Nav1 UTSW 1 135532353 missense probably benign 0.06
R2063:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2066:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2084:Nav1 UTSW 1 135607420 unclassified probably benign
R2090:Nav1 UTSW 1 135607165 utr 5 prime probably benign
R2107:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2110:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2111:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2112:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2136:Nav1 UTSW 1 135454436 missense probably null 0.18
R2268:Nav1 UTSW 1 135472236 nonsense probably null
R2269:Nav1 UTSW 1 135472236 nonsense probably null
R2847:Nav1 UTSW 1 135450644 splice site probably null
R2869:Nav1 UTSW 1 135460757 synonymous silent
R2871:Nav1 UTSW 1 135460757 synonymous silent
R2872:Nav1 UTSW 1 135460757 synonymous silent
R2904:Nav1 UTSW 1 135585238 missense probably benign
R3690:Nav1 UTSW 1 135467644 missense probably benign 0.11
R3716:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3717:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3718:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3815:Nav1 UTSW 1 135471124 missense possibly damaging 0.95
R4282:Nav1 UTSW 1 135457913 intron probably benign
R4361:Nav1 UTSW 1 135607437 unclassified probably benign
R4610:Nav1 UTSW 1 135592448 intron probably benign
R4730:Nav1 UTSW 1 135607311 unclassified probably benign
R4784:Nav1 UTSW 1 135458739 missense probably damaging 1.00
R4788:Nav1 UTSW 1 135469723 missense probably benign
R4808:Nav1 UTSW 1 135455204 missense probably damaging 1.00
R4996:Nav1 UTSW 1 135465971 missense probably damaging 1.00
R5284:Nav1 UTSW 1 135449963 nonsense probably null
R5514:Nav1 UTSW 1 135470561 missense probably benign 0.04
R5769:Nav1 UTSW 1 135452257 missense probably damaging 1.00
R5834:Nav1 UTSW 1 135532406 missense probably benign 0.07
R5898:Nav1 UTSW 1 135585146 missense probably benign
R6081:Nav1 UTSW 1 135470822 missense probably damaging 1.00
R6344:Nav1 UTSW 1 135450796 missense probably damaging 1.00
R6378:Nav1 UTSW 1 135454695 missense probably damaging 1.00
R7001:Nav1 UTSW 1 135454611 splice site probably null
R7185:Nav1 UTSW 1 135471008 missense possibly damaging 0.85
R7291:Nav1 UTSW 1 135465859 missense probably damaging 1.00
R7361:Nav1 UTSW 1 135452853 missense unknown
R7390:Nav1 UTSW 1 135584918 missense probably benign 0.01
R7464:Nav1 UTSW 1 135584909 missense probably benign 0.03
R7502:Nav1 UTSW 1 135469666 missense probably damaging 1.00
R7601:Nav1 UTSW 1 135460438 missense unknown
R7625:Nav1 UTSW 1 135467745 missense probably damaging 1.00
R7639:Nav1 UTSW 1 135471122 missense probably benign 0.09
R7786:Nav1 UTSW 1 135469995 missense probably damaging 1.00
R7808:Nav1 UTSW 1 135452248 missense unknown
R7815:Nav1 UTSW 1 135584639 missense possibly damaging 0.49
R8030:Nav1 UTSW 1 135537239 missense probably damaging 1.00
R8370:Nav1 UTSW 1 135471144 nonsense probably null
R8405:Nav1 UTSW 1 135454770 missense unknown
R8720:Nav1 UTSW 1 135460726 missense unknown
Z1088:Nav1 UTSW 1 135470724 missense probably benign 0.01
Z1176:Nav1 UTSW 1 135452886 missense unknown
Z1176:Nav1 UTSW 1 135472420 missense probably damaging 1.00
Z1177:Nav1 UTSW 1 135469731 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TAAGATACTGCTTCCAGCCCC -3'
(R):5'- AGAGCTGCTACTTAACTGTCATC -3'

Sequencing Primer
(F):5'- GATACTGCTTCCAGCCCCTCTAC -3'
(R):5'- TCACCTCCTGTCGCTTAAAAAG -3'
Posted On2019-12-03