Incidental Mutation 'R7827:Dnah8'
ID 602288
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms P1-Loop, Dnahc8, Hst6.7b
MMRRC Submission 045881-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R7827 (G1)
Quality Score 214.458
Status Not validated
Chromosome 17
Chromosomal Location 30845909-31094736 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT at 30979841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000170651
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 A G 3: 59,651,112 (GRCm39) N78S probably damaging Het
Abca12 G A 1: 71,453,837 (GRCm39) probably benign Het
Abcb1b T C 5: 8,887,747 (GRCm39) S878P probably damaging Het
Adamts20 T C 15: 94,223,814 (GRCm39) R1305G probably damaging Het
Adcy2 A T 13: 68,837,400 (GRCm39) C650S probably damaging Het
Ahnak A T 19: 8,982,708 (GRCm39) K1331* probably null Het
Alpk1 A T 3: 127,473,700 (GRCm39) S768T probably benign Het
Ap4b1 T G 3: 103,722,398 (GRCm39) L124R probably damaging Het
Arrdc2 A T 8: 71,292,038 (GRCm39) F3Y probably damaging Het
Atp9a A G 2: 168,547,114 (GRCm39) V155A probably benign Het
Bptf A G 11: 106,938,013 (GRCm39) S87P probably benign Het
Carmil1 A T 13: 24,220,421 (GRCm39) M697K probably benign Het
Ccdc42 G A 11: 68,485,022 (GRCm39) V32M probably benign Het
Cert1 A G 13: 96,753,563 (GRCm39) H391R probably damaging Het
Ces1d A G 8: 93,924,294 (GRCm39) probably null Het
Dcpp2 T G 17: 24,119,566 (GRCm39) Y127D probably damaging Het
Def8 C A 8: 124,174,060 (GRCm39) T7K probably benign Het
En2 G A 5: 28,371,594 (GRCm39) G24S probably benign Het
Evi2a T C 11: 79,418,688 (GRCm39) probably benign Het
Fam117b A T 1: 59,952,837 (GRCm39) H172L possibly damaging Het
Fam169b A G 7: 67,954,338 (GRCm39) I67M probably benign Het
Fbxo40 T A 16: 36,789,861 (GRCm39) E416D probably damaging Het
Gja8 T A 3: 96,827,635 (GRCm39) N9I possibly damaging Het
Gsg1l2 T A 11: 67,676,097 (GRCm39) C154S probably benign Het
Hdhd3 C A 4: 62,418,232 (GRCm39) probably benign Het
Hunk C T 16: 90,278,214 (GRCm39) P341L possibly damaging Het
Ighv8-5 T C 12: 115,031,258 (GRCm39) T94A possibly damaging Het
Ints3 T C 3: 90,331,319 (GRCm39) N75D probably benign Het
Krt39 T C 11: 99,409,901 (GRCm39) E212G probably damaging Het
Ldlrad4 A G 18: 68,387,495 (GRCm39) H269R probably damaging Het
Lrrc2 T A 9: 110,790,049 (GRCm39) V102E possibly damaging Het
Ltbp2 T A 12: 84,836,655 (GRCm39) I1292L probably benign Het
Mad2l1bp A T 17: 46,458,993 (GRCm39) V179E possibly damaging Het
Map3k1 A G 13: 111,892,663 (GRCm39) V864A probably benign Het
Mapk8ip2 T G 15: 89,342,322 (GRCm39) V511G probably damaging Het
Mknk2 A C 10: 80,503,021 (GRCm39) S434A probably benign Het
Mllt11 A G 3: 95,127,548 (GRCm39) F74S probably damaging Het
Muc16 G T 9: 18,506,519 (GRCm39) T6412K possibly damaging Het
Nek5 C A 8: 22,573,403 (GRCm39) A518S possibly damaging Het
Npy1r T C 8: 67,156,864 (GRCm39) F95L possibly damaging Het
Nup98 G A 7: 101,773,569 (GRCm39) T1586I probably benign Het
Olig3 A T 10: 19,232,518 (GRCm39) M48L probably benign Het
Or13n4 A G 7: 106,422,932 (GRCm39) M267T probably benign Het
Or14j7 T A 17: 38,234,568 (GRCm39) L37* probably null Het
Or5b120 T G 19: 13,480,587 (GRCm39) N293K probably damaging Het
Or6aa1 T A 7: 86,043,765 (GRCm39) K314* probably null Het
Pcdhb16 A G 18: 37,611,904 (GRCm39) D288G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phip T C 9: 82,790,886 (GRCm39) I687V probably benign Het
Piezo1 G A 8: 123,209,659 (GRCm39) T2348M probably damaging Het
Plod3 A G 5: 137,018,835 (GRCm39) T291A probably benign Het
Pmpca G A 2: 26,280,144 (GRCm39) V89I possibly damaging Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Pou6f2 C A 13: 18,553,092 (GRCm39) A81S Het
Ppl T A 16: 4,905,828 (GRCm39) E1489V probably damaging Het
Ptpdc1 A G 13: 48,733,264 (GRCm39) F792S probably damaging Het
Pus1 A G 5: 110,927,582 (GRCm39) Y58H probably damaging Het
Rex2 C A 4: 147,142,547 (GRCm39) T345N possibly damaging Het
Rnf144a T C 12: 26,389,439 (GRCm39) M1V probably null Het
Siglec15 A T 18: 78,100,445 (GRCm39) C13* probably null Het
Skint10 G A 4: 112,632,003 (GRCm39) Q6* probably null Het
Slc5a1 T C 5: 33,304,057 (GRCm39) W291R probably damaging Het
Snx27 A G 3: 94,426,366 (GRCm39) F378L probably benign Het
Strip2 A T 6: 29,923,928 (GRCm39) T81S probably benign Het
Tas2r143 A G 6: 42,377,656 (GRCm39) N162S probably damaging Het
Tatdn1 T C 15: 58,776,607 (GRCm39) D256G probably benign Het
Tbc1d5 A G 17: 51,089,291 (GRCm39) S630P probably damaging Het
Tlr11 A G 14: 50,598,611 (GRCm39) D199G probably benign Het
Tmed8 C A 12: 87,246,991 (GRCm39) probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ttll3 TAA TAAAGCAA 6: 113,376,123 (GRCm39) probably null Het
U2af2 T C 7: 5,077,661 (GRCm39) probably null Het
Ywhag C T 5: 135,940,394 (GRCm39) E67K probably damaging Het
Zfp105 A G 9: 122,759,808 (GRCm39) H493R probably damaging Het
Zfp426 A T 9: 20,381,446 (GRCm39) C514S probably damaging Het
Zfp536 T A 7: 37,269,113 (GRCm39) D101V probably damaging Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30,896,150 (GRCm39) missense probably benign 0.06
IGL00508:Dnah8 APN 17 31,074,904 (GRCm39) missense probably damaging 1.00
IGL00547:Dnah8 APN 17 31,034,677 (GRCm39) nonsense probably null
IGL00551:Dnah8 APN 17 30,882,452 (GRCm39) nonsense probably null
IGL00732:Dnah8 APN 17 30,875,615 (GRCm39) missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30,986,880 (GRCm39) nonsense probably null
IGL00840:Dnah8 APN 17 31,009,915 (GRCm39) missense probably damaging 1.00
IGL00845:Dnah8 APN 17 31,038,250 (GRCm39) critical splice donor site probably null
IGL00953:Dnah8 APN 17 30,925,431 (GRCm39) nonsense probably null
IGL00976:Dnah8 APN 17 31,070,684 (GRCm39) missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30,854,979 (GRCm39) missense probably benign 0.06
IGL01467:Dnah8 APN 17 30,998,890 (GRCm39) missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30,902,688 (GRCm39) splice site probably benign
IGL01515:Dnah8 APN 17 30,867,459 (GRCm39) missense probably benign
IGL01723:Dnah8 APN 17 30,927,445 (GRCm39) missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30,970,565 (GRCm39) critical splice donor site probably null
IGL01921:Dnah8 APN 17 30,955,115 (GRCm39) missense probably benign
IGL01958:Dnah8 APN 17 31,074,869 (GRCm39) splice site probably benign
IGL01968:Dnah8 APN 17 30,875,572 (GRCm39) nonsense probably null
IGL02093:Dnah8 APN 17 30,936,854 (GRCm39) missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30,867,391 (GRCm39) missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 31,013,737 (GRCm39) missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30,925,487 (GRCm39) critical splice donor site probably null
IGL02236:Dnah8 APN 17 30,868,747 (GRCm39) nonsense probably null
IGL02259:Dnah8 APN 17 30,978,588 (GRCm39) missense probably benign
IGL02263:Dnah8 APN 17 30,948,139 (GRCm39) missense probably benign 0.00
IGL02303:Dnah8 APN 17 30,932,021 (GRCm39) missense probably benign 0.03
IGL02341:Dnah8 APN 17 30,966,231 (GRCm39) missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02377:Dnah8 APN 17 31,013,770 (GRCm39) missense probably damaging 0.98
IGL02390:Dnah8 APN 17 31,049,819 (GRCm39) missense probably benign 0.01
IGL02392:Dnah8 APN 17 31,037,025 (GRCm39) splice site probably benign
IGL02414:Dnah8 APN 17 30,919,387 (GRCm39) missense probably benign
IGL02455:Dnah8 APN 17 30,891,308 (GRCm39) missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30,887,269 (GRCm39) missense probably benign
IGL02831:Dnah8 APN 17 30,931,250 (GRCm39) missense probably benign 0.23
IGL02863:Dnah8 APN 17 30,988,671 (GRCm39) missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30,940,084 (GRCm39) nonsense probably null
IGL02954:Dnah8 APN 17 30,923,809 (GRCm39) missense probably benign 0.30
IGL02964:Dnah8 APN 17 30,965,735 (GRCm39) missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30,937,980 (GRCm39) missense probably benign 0.01
IGL03081:Dnah8 APN 17 30,905,347 (GRCm39) splice site probably benign
IGL03086:Dnah8 APN 17 30,961,754 (GRCm39) missense probably damaging 1.00
IGL03087:Dnah8 APN 17 31,003,118 (GRCm39) missense probably benign
IGL03176:Dnah8 APN 17 30,913,011 (GRCm39) missense probably benign
IGL03191:Dnah8 APN 17 30,945,804 (GRCm39) missense probably damaging 0.99
IGL03210:Dnah8 APN 17 31,034,639 (GRCm39) missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30,892,894 (GRCm39) splice site probably null
IGL03255:Dnah8 APN 17 30,960,355 (GRCm39) missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30,891,323 (GRCm39) missense probably benign
IGL03348:Dnah8 APN 17 30,965,960 (GRCm39) missense probably damaging 0.99
Alternator UTSW 17 30,984,609 (GRCm39) missense probably benign
armature UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
Brush UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
Dynos UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
joule UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
solenoid UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30,854,437 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,451 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,439 (GRCm39) small deletion probably benign
I2288:Dnah8 UTSW 17 30,882,428 (GRCm39) missense probably benign
P0029:Dnah8 UTSW 17 30,984,694 (GRCm39) missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30,927,419 (GRCm39) missense probably benign 0.04
R0016:Dnah8 UTSW 17 30,882,290 (GRCm39) missense probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30,974,093 (GRCm39) missense probably damaging 1.00
R0090:Dnah8 UTSW 17 31,003,064 (GRCm39) missense probably benign 0.20
R0119:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0184:Dnah8 UTSW 17 30,902,657 (GRCm39) missense probably benign 0.04
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30,909,245 (GRCm39) missense probably benign
R0268:Dnah8 UTSW 17 30,988,681 (GRCm39) missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30,955,130 (GRCm39) missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 31,090,325 (GRCm39) missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
R0423:Dnah8 UTSW 17 30,920,955 (GRCm39) missense probably benign
R0470:Dnah8 UTSW 17 30,927,514 (GRCm39) splice site probably benign
R0477:Dnah8 UTSW 17 30,974,054 (GRCm39) missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R0499:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30,937,935 (GRCm39) missense probably benign 0.01
R0601:Dnah8 UTSW 17 30,927,332 (GRCm39) missense probably benign 0.06
R0646:Dnah8 UTSW 17 30,903,147 (GRCm39) missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30,955,129 (GRCm39) missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30,923,636 (GRCm39) missense probably benign
R0843:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R0940:Dnah8 UTSW 17 31,022,217 (GRCm39) missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30,892,894 (GRCm39) splice site probably null
R1102:Dnah8 UTSW 17 31,073,738 (GRCm39) splice site probably null
R1137:Dnah8 UTSW 17 31,074,910 (GRCm39) missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30,939,974 (GRCm39) missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30,956,269 (GRCm39) missense probably damaging 1.00
R1377:Dnah8 UTSW 17 31,059,596 (GRCm39) nonsense probably null
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1497:Dnah8 UTSW 17 30,971,049 (GRCm39) missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30,892,862 (GRCm39) missense probably benign
R1541:Dnah8 UTSW 17 30,966,221 (GRCm39) missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30,854,638 (GRCm39) missense probably benign 0.07
R1634:Dnah8 UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
R1670:Dnah8 UTSW 17 30,944,098 (GRCm39) missense probably damaging 1.00
R1710:Dnah8 UTSW 17 31,073,914 (GRCm39) missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30,988,625 (GRCm39) missense probably benign 0.28
R1761:Dnah8 UTSW 17 30,998,890 (GRCm39) missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30,941,911 (GRCm39) missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30,927,381 (GRCm39) missense probably benign 0.00
R1808:Dnah8 UTSW 17 30,903,160 (GRCm39) missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30,950,154 (GRCm39) missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30,854,479 (GRCm39) missense unknown
R1935:Dnah8 UTSW 17 30,945,870 (GRCm39) splice site probably benign
R1940:Dnah8 UTSW 17 30,950,181 (GRCm39) missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30,931,359 (GRCm39) missense probably benign 0.00
R2025:Dnah8 UTSW 17 30,950,133 (GRCm39) missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30,977,255 (GRCm39) missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30,854,632 (GRCm39) missense probably benign 0.01
R2148:Dnah8 UTSW 17 30,956,232 (GRCm39) missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30,872,367 (GRCm39) missense probably benign
R2180:Dnah8 UTSW 17 31,059,621 (GRCm39) missense probably benign 0.00
R2262:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2328:Dnah8 UTSW 17 31,013,718 (GRCm39) missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30,990,846 (GRCm39) missense probably benign
R2357:Dnah8 UTSW 17 31,093,909 (GRCm39) missense probably benign 0.00
R2360:Dnah8 UTSW 17 30,896,178 (GRCm39) missense probably benign 0.22
R2496:Dnah8 UTSW 17 31,070,705 (GRCm39) missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30,960,339 (GRCm39) nonsense probably null
R2509:Dnah8 UTSW 17 30,994,019 (GRCm39) missense probably benign 0.02
R3114:Dnah8 UTSW 17 31,052,542 (GRCm39) missense probably benign 0.04
R3708:Dnah8 UTSW 17 30,958,631 (GRCm39) missense probably damaging 0.98
R3720:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3722:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30,958,622 (GRCm39) nonsense probably null
R3747:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3748:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3749:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3787:Dnah8 UTSW 17 30,974,015 (GRCm39) missense probably damaging 1.00
R3790:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30,889,621 (GRCm39) missense probably benign 0.00
R3857:Dnah8 UTSW 17 30,882,396 (GRCm39) missense probably damaging 0.96
R3898:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3899:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3938:Dnah8 UTSW 17 31,073,911 (GRCm39) missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30,913,039 (GRCm39) splice site probably benign
R4091:Dnah8 UTSW 17 30,988,813 (GRCm39) missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30,967,533 (GRCm39) missense probably benign
R4326:Dnah8 UTSW 17 30,971,066 (GRCm39) missense probably benign 0.04
R4346:Dnah8 UTSW 17 30,944,072 (GRCm39) missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30,971,120 (GRCm39) missense probably damaging 1.00
R4457:Dnah8 UTSW 17 31,032,125 (GRCm39) missense probably benign
R4475:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4565:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4566:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4568:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4573:Dnah8 UTSW 17 30,919,380 (GRCm39) missense probably benign 0.00
R4580:Dnah8 UTSW 17 30,881,026 (GRCm39) missense probably benign 0.00
R4585:Dnah8 UTSW 17 30,970,541 (GRCm39) missense probably benign 0.01
R4611:Dnah8 UTSW 17 30,903,211 (GRCm39) missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30,902,608 (GRCm39) missense probably benign 0.08
R4721:Dnah8 UTSW 17 30,944,140 (GRCm39) missense probably damaging 1.00
R4727:Dnah8 UTSW 17 31,070,721 (GRCm39) missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4732:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4733:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4798:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4814:Dnah8 UTSW 17 30,986,898 (GRCm39) missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4894:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4900:Dnah8 UTSW 17 30,965,949 (GRCm39) missense probably damaging 1.00
R4901:Dnah8 UTSW 17 31,059,688 (GRCm39) critical splice donor site probably null
R4913:Dnah8 UTSW 17 31,038,113 (GRCm39) missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4932:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4933:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4942:Dnah8 UTSW 17 30,948,116 (GRCm39) missense probably benign
R4969:Dnah8 UTSW 17 30,941,988 (GRCm39) missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4977:Dnah8 UTSW 17 30,882,275 (GRCm39) missense probably benign 0.00
R5001:Dnah8 UTSW 17 31,006,159 (GRCm39) missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5013:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5014:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5024:Dnah8 UTSW 17 30,955,070 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5075:Dnah8 UTSW 17 31,019,505 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,958,731 (GRCm39) critical splice donor site probably null
R5112:Dnah8 UTSW 17 30,950,012 (GRCm39) missense probably benign 0.02
R5121:Dnah8 UTSW 17 31,029,327 (GRCm39) missense probably benign 0.14
R5138:Dnah8 UTSW 17 30,984,571 (GRCm39) missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30,931,269 (GRCm39) missense probably benign 0.06
R5191:Dnah8 UTSW 17 30,965,739 (GRCm39) missense probably damaging 1.00
R5238:Dnah8 UTSW 17 31,009,891 (GRCm39) missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R5358:Dnah8 UTSW 17 30,965,928 (GRCm39) missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5404:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5482:Dnah8 UTSW 17 31,019,521 (GRCm39) missense probably damaging 0.96
R5489:Dnah8 UTSW 17 31,009,930 (GRCm39) missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30,971,890 (GRCm39) missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30,925,360 (GRCm39) missense probably benign 0.00
R5640:Dnah8 UTSW 17 31,022,082 (GRCm39) missense probably damaging 1.00
R5649:Dnah8 UTSW 17 31,019,561 (GRCm39) missense probably benign 0.13
R5662:Dnah8 UTSW 17 30,956,307 (GRCm39) missense probably damaging 1.00
R5673:Dnah8 UTSW 17 31,022,235 (GRCm39) missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5699:Dnah8 UTSW 17 31,029,298 (GRCm39) missense probably benign 0.22
R5737:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5738:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5739:Dnah8 UTSW 17 30,937,981 (GRCm39) missense probably benign 0.00
R5766:Dnah8 UTSW 17 30,909,235 (GRCm39) missense probably benign 0.01
R5790:Dnah8 UTSW 17 31,093,978 (GRCm39) missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30,947,165 (GRCm39) missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 31,013,737 (GRCm39) missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5886:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5887:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30,875,659 (GRCm39) missense probably benign 0.32
R5979:Dnah8 UTSW 17 31,034,638 (GRCm39) nonsense probably null
R5986:Dnah8 UTSW 17 31,070,604 (GRCm39) missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30,882,279 (GRCm39) missense probably benign 0.32
R6042:Dnah8 UTSW 17 30,966,239 (GRCm39) missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6181:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6237:Dnah8 UTSW 17 30,966,828 (GRCm39) nonsense probably null
R6239:Dnah8 UTSW 17 31,029,333 (GRCm39) missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6365:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6416:Dnah8 UTSW 17 30,984,609 (GRCm39) missense probably benign
R6443:Dnah8 UTSW 17 30,990,859 (GRCm39) missense probably benign 0.10
R6478:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6479:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6480:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6481:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6533:Dnah8 UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6608:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6610:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6675:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6723:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6724:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6754:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6755:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6759:Dnah8 UTSW 17 30,882,266 (GRCm39) splice site probably null
R6765:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6766:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6778:Dnah8 UTSW 17 30,854,640 (GRCm39) missense probably benign 0.00
R6781:Dnah8 UTSW 17 30,984,698 (GRCm39) frame shift probably null
R6788:Dnah8 UTSW 17 30,867,439 (GRCm39) missense probably benign 0.14
R6814:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30,960,147 (GRCm39) missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30,929,525 (GRCm39) missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30,965,933 (GRCm39) missense probably damaging 1.00
R6944:Dnah8 UTSW 17 31,013,633 (GRCm39) missense probably benign 0.09
R6982:Dnah8 UTSW 17 30,986,899 (GRCm39) missense probably benign 0.03
R6984:Dnah8 UTSW 17 30,958,712 (GRCm39) missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30,881,065 (GRCm39) missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30,862,249 (GRCm39) missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30,923,698 (GRCm39) missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
R7112:Dnah8 UTSW 17 31,090,366 (GRCm39) missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30,988,618 (GRCm39) missense possibly damaging 0.90
R7146:Dnah8 UTSW 17 30,863,591 (GRCm39) missense probably benign 0.01
R7309:Dnah8 UTSW 17 31,093,988 (GRCm39) missense probably damaging 1.00
R7324:Dnah8 UTSW 17 31,003,099 (GRCm39) missense probably benign 0.01
R7373:Dnah8 UTSW 17 30,986,939 (GRCm39) critical splice donor site probably null
R7423:Dnah8 UTSW 17 30,923,743 (GRCm39) missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30,925,363 (GRCm39) missense probably damaging 0.98
R7450:Dnah8 UTSW 17 31,006,165 (GRCm39) missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30,994,077 (GRCm39) missense probably damaging 0.98
R7604:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R7635:Dnah8 UTSW 17 31,004,081 (GRCm39) missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30,868,651 (GRCm39) missense probably benign 0.00
R7685:Dnah8 UTSW 17 30,876,947 (GRCm39) missense probably damaging 1.00
R7793:Dnah8 UTSW 17 31,074,918 (GRCm39) missense probably benign 0.20
R7866:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30,882,348 (GRCm39) missense probably benign
R7891:Dnah8 UTSW 17 30,931,263 (GRCm39) missense probably benign 0.09
R7977:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30,960,311 (GRCm39) nonsense probably null
R8076:Dnah8 UTSW 17 31,003,127 (GRCm39) missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30,892,797 (GRCm39) missense probably damaging 1.00
R8199:Dnah8 UTSW 17 31,090,393 (GRCm39) missense probably benign 0.06
R8253:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8270:Dnah8 UTSW 17 31,059,687 (GRCm39) missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30,984,701 (GRCm39) missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30,988,805 (GRCm39) missense probably benign 0.12
R8348:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8348:Dnah8 UTSW 17 30,955,121 (GRCm39) missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30,862,234 (GRCm39) missense probably benign 0.17
R8355:Dnah8 UTSW 17 30,914,152 (GRCm39) missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8448:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8459:Dnah8 UTSW 17 30,944,221 (GRCm39) critical splice donor site probably null
R8462:Dnah8 UTSW 17 30,875,603 (GRCm39) missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30,940,108 (GRCm39) missense probably benign
R8524:Dnah8 UTSW 17 30,934,472 (GRCm39) missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30,940,084 (GRCm39) nonsense probably null
R8698:Dnah8 UTSW 17 31,094,009 (GRCm39) missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30,960,289 (GRCm39) missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8781:Dnah8 UTSW 17 30,944,078 (GRCm39) missense probably damaging 1.00
R8821:Dnah8 UTSW 17 31,013,712 (GRCm39) missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30,981,616 (GRCm39) missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30,927,286 (GRCm39) missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 31,070,628 (GRCm39) missense probably damaging 0.98
R8994:Dnah8 UTSW 17 31,009,807 (GRCm39) missense probably benign 0.05
R9031:Dnah8 UTSW 17 30,956,401 (GRCm39) missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30,975,729 (GRCm39) missense possibly damaging 0.63
R9225:Dnah8 UTSW 17 30,854,647 (GRCm39) missense probably benign 0.01
R9280:Dnah8 UTSW 17 31,004,071 (GRCm39) missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30,944,099 (GRCm39) missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30,990,857 (GRCm39) missense probably benign
R9347:Dnah8 UTSW 17 30,927,333 (GRCm39) missense probably benign 0.00
R9393:Dnah8 UTSW 17 30,872,361 (GRCm39) missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 31,029,297 (GRCm39) missense probably benign 0.02
R9458:Dnah8 UTSW 17 31,049,777 (GRCm39) missense probably damaging 1.00
R9465:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9518:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9524:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9564:Dnah8 UTSW 17 30,932,021 (GRCm39) missense probably benign 0.07
R9587:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9599:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9641:Dnah8 UTSW 17 30,932,029 (GRCm39) missense probably benign 0.13
R9674:Dnah8 UTSW 17 30,998,112 (GRCm39) missense possibly damaging 0.84
R9679:Dnah8 UTSW 17 31,037,115 (GRCm39) missense probably benign
R9789:Dnah8 UTSW 17 30,980,104 (GRCm39) critical splice donor site probably null
RF027:Dnah8 UTSW 17 30,854,450 (GRCm39) frame shift probably null
X0001:Dnah8 UTSW 17 30,967,654 (GRCm39) missense probably damaging 1.00
X0013:Dnah8 UTSW 17 31,038,160 (GRCm39) missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30,867,514 (GRCm39) missense probably benign
Z1177:Dnah8 UTSW 17 30,932,069 (GRCm39) missense probably null 1.00
Z1177:Dnah8 UTSW 17 30,913,007 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTAAACCACGGTAGGCAAG -3'
(R):5'- TTAACGAGGTGAGTCATGGCG -3'

Sequencing Primer
(F):5'- CAAGGCTTGCTTCAGAGTGAC -3'
(R):5'- ATTGCCTCTGGTAGAACTGAAGC -3'
Posted On 2019-12-03