Incidental Mutation 'R7835:Mrpl19'
ID605910
Institutional Source Beutler Lab
Gene Symbol Mrpl19
Ensembl Gene ENSMUSG00000030045
Gene Namemitochondrial ribosomal protein L19
SynonymsRpml15, D6Ertd157e, 9030416F12Rik, RLX1, MRP-L15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location81957851-81965958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81962126 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 232 (R232C)
Ref Sequence ENSEMBL: ENSMUSP00000032124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032124] [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably damaging
Transcript: ENSMUST00000032124
AA Change: R232C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032124
Gene: ENSMUSG00000030045
AA Change: R232C

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Ribosomal_L19 92 198 9e-19 PFAM
SCOP:d1fura_ 214 282 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043195
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203959
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Mrpl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL00563:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL02113:Mrpl19 APN 6 81965915 missense probably benign
IGL02116:Mrpl19 APN 6 81965777 missense probably benign 0.41
IGL02256:Mrpl19 APN 6 81964319 missense probably benign 0.06
IGL02347:Mrpl19 APN 6 81962011 missense probably damaging 0.99
IGL02415:Mrpl19 APN 6 81963961 missense probably benign 0.29
IGL02825:Mrpl19 APN 6 81965815 missense probably benign 0.25
IGL03189:Mrpl19 APN 6 81961993 nonsense probably null
R1824:Mrpl19 UTSW 6 81964079 splice site probably null
R2310:Mrpl19 UTSW 6 81964073 splice site probably null
R3176:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R3276:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R3821:Mrpl19 UTSW 6 81962006 nonsense probably null
R4705:Mrpl19 UTSW 6 81964285 missense probably damaging 0.99
R4736:Mrpl19 UTSW 6 81964348 missense probably damaging 1.00
R5464:Mrpl19 UTSW 6 81962011 missense probably damaging 0.99
R7408:Mrpl19 UTSW 6 81965812 missense possibly damaging 0.65
R7956:Mrpl19 UTSW 6 81963981 missense probably benign 0.00
R8432:Mrpl19 UTSW 6 81962155 missense probably damaging 1.00
Z1177:Mrpl19 UTSW 6 81964310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCAAGACTTCTTCGATGCTTC -3'
(R):5'- TGACGTGAACATGAAGCCGG -3'

Sequencing Primer
(F):5'- GCTTCTATTTCTTCCCACAATGCAG -3'
(R):5'- TGCCTGTTAACAAGGTAGATGC -3'
Posted On2019-12-20