Incidental Mutation 'R7847:2300002M23Rik'
ID606704
Institutional Source Beutler Lab
Gene Symbol 2300002M23Rik
Ensembl Gene ENSMUSG00000039269
Gene NameRIKEN cDNA 2300002M23 gene
Synonymsemprin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35567450-35568952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35568652 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 296 (Y296N)
Ref Sequence ENSEMBL: ENSMUSP00000038043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044326]
Predicted Effect probably benign
Transcript: ENSMUST00000044326
AA Change: Y296N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038043
Gene: ENSMUSG00000039269
AA Change: Y296N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:STG 34 260 4.8e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Female homozygous null mice exhibit reduced body weight and total body fat. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in 2300002M23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:2300002M23Rik APN 17 35567833 critical splice acceptor site probably null
IGL02604:2300002M23Rik APN 17 35567948 missense probably benign 0.01
R1154:2300002M23Rik UTSW 17 35568776 missense probably damaging 1.00
R2184:2300002M23Rik UTSW 17 35568218 missense probably benign
R2406:2300002M23Rik UTSW 17 35568455 missense probably damaging 0.96
R3824:2300002M23Rik UTSW 17 35567611 missense probably benign
R4739:2300002M23Rik UTSW 17 35567506 utr 5 prime probably benign
R4936:2300002M23Rik UTSW 17 35568315 missense possibly damaging 0.92
R5318:2300002M23Rik UTSW 17 35567986 missense possibly damaging 0.95
R5459:2300002M23Rik UTSW 17 35568182 missense possibly damaging 0.91
R6453:2300002M23Rik UTSW 17 35568212 missense possibly damaging 0.71
R6761:2300002M23Rik UTSW 17 35567948 missense probably benign 0.01
R7930:2300002M23Rik UTSW 17 35568652 missense probably benign
RF010:2300002M23Rik UTSW 17 35568576 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGAATATGGGGTAGCAATG -3'
(R):5'- CGCTGCAAACCAGTTGTGAG -3'

Sequencing Primer
(F):5'- GTAGCAATGGTTTAGTATCAGGTAC -3'
(R):5'- CGCTGCAAACCAGTTGTGAGATTAG -3'
Posted On2019-12-20