Incidental Mutation 'R7847:2300002M23Rik'
ID 606704
Institutional Source Beutler Lab
Gene Symbol 2300002M23Rik
Ensembl Gene ENSMUSG00000039269
Gene Name RIKEN cDNA 2300002M23 gene
Synonyms emprin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock # R7847 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 35567450-35568952 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35568652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 296 (Y296N)
Ref Sequence ENSEMBL: ENSMUSP00000038043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044326]
AlphaFold Q8BM15
Predicted Effect probably benign
Transcript: ENSMUST00000044326
AA Change: Y296N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038043
Gene: ENSMUSG00000039269
AA Change: Y296N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:STG 34 260 4.8e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Female homozygous null mice exhibit reduced body weight and total body fat. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in 2300002M23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:2300002M23Rik APN 17 35567833 critical splice acceptor site probably null
IGL02604:2300002M23Rik APN 17 35567948 missense probably benign 0.01
R1154:2300002M23Rik UTSW 17 35568776 missense probably damaging 1.00
R2184:2300002M23Rik UTSW 17 35568218 missense probably benign
R2406:2300002M23Rik UTSW 17 35568455 missense probably damaging 0.96
R3824:2300002M23Rik UTSW 17 35567611 missense probably benign
R4739:2300002M23Rik UTSW 17 35567506 utr 5 prime probably benign
R4936:2300002M23Rik UTSW 17 35568315 missense possibly damaging 0.92
R5318:2300002M23Rik UTSW 17 35567986 missense possibly damaging 0.95
R5459:2300002M23Rik UTSW 17 35568182 missense possibly damaging 0.91
R6453:2300002M23Rik UTSW 17 35568212 missense possibly damaging 0.71
R6761:2300002M23Rik UTSW 17 35567948 missense probably benign 0.01
R9406:2300002M23Rik UTSW 17 35568590 missense possibly damaging 0.96
RF010:2300002M23Rik UTSW 17 35568576 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGAATATGGGGTAGCAATG -3'
(R):5'- CGCTGCAAACCAGTTGTGAG -3'

Sequencing Primer
(F):5'- GTAGCAATGGTTTAGTATCAGGTAC -3'
(R):5'- CGCTGCAAACCAGTTGTGAGATTAG -3'
Posted On 2019-12-20