Incidental Mutation 'R7847:Phactr1'
ID606699
Institutional Source Beutler Lab
Gene Symbol Phactr1
Ensembl Gene ENSMUSG00000054728
Gene Namephosphatase and actin regulator 1
SynonymsRpel1, 9630030F18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location42680623-43138526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43057188 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 169 (L169P)
Ref Sequence ENSEMBL: ENSMUSP00000122232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066928] [ENSMUST00000110161] [ENSMUST00000128646] [ENSMUST00000131942] [ENSMUST00000148891] [ENSMUST00000149235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066928
AA Change: L162P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066663
Gene: ENSMUSG00000054728
AA Change: L162P

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 219 239 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
RPEL 415 440 1.23e-6 SMART
RPEL 453 478 5.14e-9 SMART
RPEL 491 516 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110161
AA Change: L169P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105790
Gene: ENSMUSG00000054728
AA Change: L169P

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 295 315 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
RPEL 491 516 1.23e-6 SMART
RPEL 529 554 5.14e-9 SMART
RPEL 567 592 2.71e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128646
AA Change: L169P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122232
Gene: ENSMUSG00000054728
AA Change: L169P

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131942
AA Change: L77P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123346
Gene: ENSMUSG00000054728
AA Change: L77P

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
RPEL 46 71 7.33e-5 SMART
low complexity region 85 103 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
low complexity region 203 223 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 372 383 N/A INTRINSIC
RPEL 399 424 1.23e-6 SMART
RPEL 437 462 5.14e-9 SMART
RPEL 475 500 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148891
AA Change: L162P

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115228
Gene: ENSMUSG00000054728
AA Change: L162P

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 216 225 N/A INTRINSIC
low complexity region 288 308 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
RPEL 484 509 1.23e-6 SMART
RPEL 522 547 5.14e-9 SMART
RPEL 560 585 2.71e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149235
AA Change: L169P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115207
Gene: ENSMUSG00000054728
AA Change: L169P

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphatase and actin regulator family of proteins. This family member can bind actin and regulate the reorganization of the actin cytoskeleton. It plays a role in tubule formation and in endothelial cell survival. Polymorphisms in this gene are associated with susceptibility to myocardial infarction, coronary artery disease and cervical artery dissection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Phactr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Phactr1 APN 13 42956646 missense probably damaging 0.99
IGL01144:Phactr1 APN 13 43037524 missense possibly damaging 0.93
IGL02193:Phactr1 APN 13 42709700 splice site probably benign
IGL02691:Phactr1 APN 13 43077737 missense probably benign 0.38
R0028:Phactr1 UTSW 13 43057179 missense probably damaging 1.00
R0060:Phactr1 UTSW 13 42682721 nonsense probably null
R0522:Phactr1 UTSW 13 43059591 missense probably benign 0.00
R1354:Phactr1 UTSW 13 43057331 missense possibly damaging 0.91
R1382:Phactr1 UTSW 13 43132975 missense probably damaging 1.00
R1496:Phactr1 UTSW 13 43094990 missense probably damaging 0.98
R1620:Phactr1 UTSW 13 43094897 missense probably damaging 1.00
R1638:Phactr1 UTSW 13 42956671 missense probably damaging 1.00
R1679:Phactr1 UTSW 13 43057280 missense possibly damaging 0.65
R1679:Phactr1 UTSW 13 43094781 missense possibly damaging 0.94
R2055:Phactr1 UTSW 13 43077940 missense probably damaging 1.00
R2137:Phactr1 UTSW 13 43135175 missense possibly damaging 0.77
R2276:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R2279:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R3122:Phactr1 UTSW 13 43059573 missense possibly damaging 0.94
R4073:Phactr1 UTSW 13 43059769 intron probably benign
R4131:Phactr1 UTSW 13 43037477 missense probably damaging 0.99
R4237:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4238:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4239:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4240:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4507:Phactr1 UTSW 13 43096794 missense probably damaging 0.96
R4602:Phactr1 UTSW 13 43094965 missense probably benign 0.00
R4914:Phactr1 UTSW 13 43133963 missense possibly damaging 0.58
R5382:Phactr1 UTSW 13 43135219 utr 3 prime probably benign
R5882:Phactr1 UTSW 13 42709851 critical splice donor site probably null
R6253:Phactr1 UTSW 13 43094771 missense probably benign 0.06
R6451:Phactr1 UTSW 13 43132993 missense probably damaging 1.00
R6808:Phactr1 UTSW 13 43132969 missense probably damaging 1.00
R7061:Phactr1 UTSW 13 43132981 missense probably damaging 1.00
R7912:Phactr1 UTSW 13 42709763 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTCTCATAGGACACACCCATG -3'
(R):5'- TGCCATGTCATTACCTGGTC -3'

Sequencing Primer
(F):5'- TCTCATAGGACACACCCATGCATAG -3'
(R):5'- GGTCCATCCATAATGTCTGAAGC -3'
Posted On2019-12-20