Incidental Mutation 'R7847:Man2a2'
ID606684
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Namemannosidase 2, alpha 2
Synonymsalpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80349097-80371375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 80368865 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 82 (A82G)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000205436] [ENSMUST00000206212] [ENSMUST00000206301]
Predicted Effect probably benign
Transcript: ENSMUST00000098346
AA Change: A82G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: A82G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205436
Predicted Effect probably benign
Transcript: ENSMUST00000206212
Predicted Effect probably benign
Transcript: ENSMUST00000206301
AA Change: A82G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGGTTAACATCTGCCG -3'
(R):5'- TGCCTTGTGTAATAATAGCCTGAC -3'

Sequencing Primer
(F):5'- AATGCAGCTCAGTGCCTGTC -3'
(R):5'- AGCCTGACTTAAGTTTCTGGCAGAC -3'
Posted On2019-12-20