Mutagenetix > Incidental Mutation

Incidental Mutation 'R6338:Fem1b'

514332

Institutional Source

Beutler Lab

Gene Symbol

Fem1b

Ensembl Gene

ENSMUSG00000032244

Gene Name

feminization 1 homolog b (C. elegans)

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62791821-62811934 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62797011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 322 (D322E)

Ref Sequence

ENSEMBL: ENSMUSP00000034775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034775]

AlphaFold

Q9Z2G0

Predicted Effect

probably benign
Transcript: ENSMUST00000034775
AA Change: D322E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000034775
Gene: ENSMUSG00000032244
AA Change: D322E

Domain	Start	End	E-Value	Type
ANK	45	74	6.81e-3	SMART
ANK	87	116	6.65e-6	SMART
ANK	120	149	8.39e-3	SMART
ANK	153	182	8.91e-7	SMART
ANK	186	215	4.13e-2	SMART
ANK	218	246	6.71e-2	SMART
ANK	483	527	1.72e1	SMART
ANK	531	570	6.05e2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous targeted mutants display abnormal glucose tolerance due to defective glucose-stimulated insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Fem1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Fem1b	APN	9	62796919	missense	probably damaging	1.00
IGL01306:Fem1b	APN	9	62797528	missense	possibly damaging	0.69
IGL02059:Fem1b	APN	9	62796164	missense	possibly damaging	0.57
IGL02292:Fem1b	APN	9	62796695	missense	probably benign	0.00
IGL03390:Fem1b	APN	9	62796964	missense	probably benign	0.01
physeter	UTSW	9	62797634	missense	probably damaging	0.99
ANU23:Fem1b	UTSW	9	62797528	missense	possibly damaging	0.69
R0054:Fem1b	UTSW	9	62796800	missense	probably damaging	1.00
R0054:Fem1b	UTSW	9	62796800	missense	probably damaging	1.00
R0733:Fem1b	UTSW	9	62796843	missense	possibly damaging	0.50
R1661:Fem1b	UTSW	9	62797274	missense	probably damaging	0.96
R1697:Fem1b	UTSW	9	62797174	missense	possibly damaging	0.56
R2228:Fem1b	UTSW	9	62796738	nonsense	probably null
R2326:Fem1b	UTSW	9	62797003	missense	probably damaging	0.98
R3123:Fem1b	UTSW	9	62796554	missense	probably benign	0.00
R3124:Fem1b	UTSW	9	62796554	missense	probably benign	0.00
R3125:Fem1b	UTSW	9	62796554	missense	probably benign	0.00
R4849:Fem1b	UTSW	9	62797294	missense	probably damaging	1.00
R5749:Fem1b	UTSW	9	62797006	missense	probably damaging	1.00
R6727:Fem1b	UTSW	9	62796733	missense	possibly damaging	0.65
R7036:Fem1b	UTSW	9	62797028	missense	probably damaging	1.00
R7287:Fem1b	UTSW	9	62796122	missense	probably benign	0.00
R7538:Fem1b	UTSW	9	62811167	missense	probably damaging	0.98
R7877:Fem1b	UTSW	9	62796562	missense	probably benign	0.13
R8079:Fem1b	UTSW	9	62796361	missense	probably damaging	1.00
R8110:Fem1b	UTSW	9	62796268	missense	probably damaging	1.00
R8682:Fem1b	UTSW	9	62797150	nonsense	probably null
R8924:Fem1b	UTSW	9	62797634	missense	probably damaging	0.99
R9334:Fem1b	UTSW	9	62796322	nonsense	probably null
R9592:Fem1b	UTSW	9	62797677	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCAAACCGAAGCAGATC -3'
(R):5'- GTGCCTCCTTTGCAAATGATC -3'

Sequencing Primer
(F):5'- CAAACCGAAGCAGATCTTTGTG -3'
(R):5'- GCCTCCTTTGCAAATGATCGTGAG -3'

Posted On

2018-04-27