Incidental Mutation 'R8124:Spata3'
ID631629
Institutional Source Beutler Lab
Gene Symbol Spata3
Ensembl Gene ENSMUSG00000026226
Gene Namespermatogenesis associated 3
Synonyms1700029H01Rik, TSARG1, 1700011N12Rik, 4930424D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location86016816-86029958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86024353 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 110 (R110C)
Ref Sequence ENSEMBL: ENSMUSP00000050509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052854] [ENSMUST00000113344] [ENSMUST00000125083] [ENSMUST00000130504] [ENSMUST00000135440] [ENSMUST00000149469] [ENSMUST00000152501] [ENSMUST00000153247] [ENSMUST00000159876]
Predicted Effect unknown
Transcript: ENSMUST00000052854
AA Change: R110C
SMART Domains Protein: ENSMUSP00000050509
Gene: ENSMUSG00000026226
AA Change: R110C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
low complexity region 169 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113344
AA Change: R109C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108971
Gene: ENSMUSG00000026226
AA Change: R109C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 168 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125083
SMART Domains Protein: ENSMUSP00000120768
Gene: ENSMUSG00000026226

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130504
AA Change: R109C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116903
Gene: ENSMUSG00000026226
AA Change: R109C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 168 190 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123844
Gene: ENSMUSG00000026226
AA Change: R90C

DomainStartEndE-ValueType
Pfam:SPATA3 1 173 8.4e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135440
AA Change: R110C
SMART Domains Protein: ENSMUSP00000123587
Gene: ENSMUSG00000026226
AA Change: R110C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149469
AA Change: R250C

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000152501
AA Change: R109C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123194
Gene: ENSMUSG00000026226
AA Change: R109C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153247
SMART Domains Protein: ENSMUSP00000117650
Gene: ENSMUSG00000026226

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159876
AA Change: R110C
SMART Domains Protein: ENSMUSP00000124671
Gene: ENSMUSG00000026226
AA Change: R110C

DomainStartEndE-ValueType
Pfam:SPATA3 1 192 1.1e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Spata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Spata3 APN 1 86022308 missense possibly damaging 0.51
IGL02553:Spata3 APN 1 86024489 missense probably damaging 1.00
IGL02736:Spata3 APN 1 86024435 missense probably damaging 0.98
PIT4696001:Spata3 UTSW 1 86024447 missense unknown
R1930:Spata3 UTSW 1 86022061 intron probably benign
R1931:Spata3 UTSW 1 86022061 intron probably benign
R4472:Spata3 UTSW 1 86026430 missense probably benign 0.05
R4579:Spata3 UTSW 1 86026453 missense probably damaging 0.97
R4824:Spata3 UTSW 1 86024326 critical splice acceptor site probably null
R7823:Spata3 UTSW 1 86022059 intron probably benign
R8062:Spata3 UTSW 1 86024426 missense unknown
R8123:Spata3 UTSW 1 86024353 missense unknown
R8125:Spata3 UTSW 1 86024353 missense unknown
R8126:Spata3 UTSW 1 86024353 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGATGCCCTACAACACCTG -3'
(R):5'- ACAGTTGCCAACCAGATCTG -3'

Sequencing Primer
(F):5'- GCTAGAATCCGCCTCTTAGC -3'
(R):5'- GGAACTCTACACCCAAGGCTTTTTAG -3'
Posted On2020-06-30