Mutagenetix > Incidental Mutations

Incidental Mutation 'R8124:Etl4'

631631

Institutional Source

Beutler Lab

Gene Symbol

Etl4

Ensembl Gene

ENSMUSG00000036617

Gene Name

enhancer trap locus 4

Synonyms

6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.809) question?

Stock #

R8124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19909780-20810713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20806640 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1546 (D1546G)

Ref Sequence

ENSEMBL: ENSMUSP00000110274 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114614] [ENSMUST00000114627]

Predicted Effect

probably benign
Transcript: ENSMUST00000045555

SMART Domains

Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1067	1096	N/A	INTRINSIC
low complexity region	1212	1231	N/A	INTRINSIC
low complexity region	1296	1314	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066509
AA Change: D1495G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: D1495G

Domain	Start	End	E-Value	Type
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1372	1381	N/A	INTRINSIC
low complexity region	1470	1495	N/A	INTRINSIC
low complexity region	1571	1582	N/A	INTRINSIC
coiled coil region	1658	1686	N/A	INTRINSIC
low complexity region	1724	1737	N/A	INTRINSIC
low complexity region	1806	1825	N/A	INTRINSIC
low complexity region	1890	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114604

SMART Domains

Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1207	1226	N/A	INTRINSIC
low complexity region	1291	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114606

SMART Domains

Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114607

SMART Domains

Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114608
AA Change: D1178G

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: D1178G

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC
low complexity region	1055	1064	N/A	INTRINSIC
low complexity region	1153	1178	N/A	INTRINSIC
low complexity region	1254	1265	N/A	INTRINSIC
coiled coil region	1341	1369	N/A	INTRINSIC
low complexity region	1407	1420	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114614

SMART Domains

Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
low complexity region	1201	1220	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114627
AA Change: D1546G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: D1546G

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
Pfam:AIP3	239	341	2.4e-14	PFAM
low complexity region	364	379	N/A	INTRINSIC
low complexity region	401	419	N/A	INTRINSIC
Pfam:AIP3	600	841	1.1e-12	PFAM
low complexity region	1153	1182	N/A	INTRINSIC
low complexity region	1423	1432	N/A	INTRINSIC
low complexity region	1521	1546	N/A	INTRINSIC
low complexity region	1622	1633	N/A	INTRINSIC
coiled coil region	1709	1737	N/A	INTRINSIC
low complexity region	1775	1788	N/A	INTRINSIC
low complexity region	1857	1876	N/A	INTRINSIC
low complexity region	1941	1959	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap3	T	A	5: 24,478,130	I320N	probably benign	Het
Ahnak	G	A	19: 9,007,123	G1924S	probably damaging	Het
Ap2a2	G	A	7: 141,598,844	R141H	probably benign	Het
Atf7ip2	T	C	16: 10,209,135	V89A	possibly damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Csnk2a2	G	A	8: 95,455,947	P296L		Het
Dab2	T	A	15: 6,429,397	C263*	probably null	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Ddx60	C	T	8: 61,983,911	A965V	probably benign	Het
Dennd5a	A	T	7: 109,897,935	I1119N	probably damaging	Het
Dpy30	A	G	17: 74,316,104		probably benign	Het
Epg5	G	A	18: 77,964,996	A780T	probably benign	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
F13a1	T	C	13: 37,025,805	K62R	probably damaging	Het
Gm2832	T	C	14: 41,278,937	M44T		Het
Gm884	A	G	11: 103,620,431	V237A	unknown	Het
Gm9195	T	C	14: 72,442,623	I2249V	probably benign	Het
Hmcn2	T	C	2: 31,400,124	V2323A	probably benign	Het
Ice2	T	A	9: 69,400,495	N20K	probably damaging	Het
Klf15	T	C	6: 90,466,881	F146S	probably damaging	Het
Lgi3	A	G	14: 70,534,738	Y241C	probably damaging	Het
Lig4	A	T	8: 9,972,954	D275E	probably damaging	Het
Lrit1	T	A	14: 37,062,048	S444R	probably benign	Het
Mip	T	C	10: 128,226,201	V107A	possibly damaging	Het
Myo15	G	A	11: 60,507,453	V1581M		Het
Nckap1l	A	G	15: 103,473,821	D481G	possibly damaging	Het
Obox3	A	T	7: 15,589,949		probably null	Het
Olfr1438-ps1	T	A	19: 12,333,470	N129Y	probably damaging	Het
Olfr491	C	A	7: 108,317,777	N294K	possibly damaging	Het
Olfr707	G	A	7: 106,891,881	T76I	possibly damaging	Het
Olfr749	C	T	14: 50,736,286	R292H	probably benign	Het
Olfr944	T	C	9: 39,217,671	F105L	probably benign	Het
Papd7	G	A	13: 69,533,597		probably benign	Het
Pilrb2	T	A	5: 137,871,044	E98V	probably damaging	Het
Plekhm1	A	G	11: 103,366,949	V1053A	probably benign	Het
Prdm2	A	T	4: 143,135,265	V485E	probably damaging	Het
Riox2	G	A	16: 59,486,591	E282K	probably benign	Het
Rps6ka2	T	A	17: 7,281,829	V379E	possibly damaging	Het
Skiv2l2	A	C	13: 112,927,337	D7E	probably benign	Het
Slc4a7	G	A	14: 14,729,211	E20K	possibly damaging	Het
Sned1	G	A	1: 93,282,989		probably null	Het
Spata3	C	T	1: 86,024,353	R110C	unknown	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Tmem132d	T	C	5: 127,792,560	Q570R	probably damaging	Het
Tmem87a	T	C	2: 120,392,195	T168A	probably benign	Het
Trank1	A	G	9: 111,378,927	R1747G	probably benign	Het
Txk	C	T	5: 72,703,263		probably null	Het
Vcan	T	A	13: 89,704,254	L862F	possibly damaging	Het
Wdr64	A	T	1: 175,799,278		probably null	Het
Zfp106	G	T	2: 120,524,331	Q1343K	probably benign	Het
Zfp719	A	G	7: 43,589,890	T301A	probably benign	Het

Other mutations in Etl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00907:Etl4	APN	2	20766478	missense	possibly damaging	0.81
IGL00944:Etl4	APN	2	20530054	missense	possibly damaging	0.52
IGL01078:Etl4	APN	2	20806531	nonsense	probably null
IGL01099:Etl4	APN	2	20807111	missense	probably benign	0.06
IGL01337:Etl4	APN	2	20785387	missense	probably benign	0.01
IGL01348:Etl4	APN	2	20806973	missense	probably damaging	1.00
IGL01349:Etl4	APN	2	20713396	missense	probably damaging	1.00
IGL01407:Etl4	APN	2	20743856	missense	probably damaging	0.99
IGL01552:Etl4	APN	2	20778189	missense	probably damaging	0.99
IGL01662:Etl4	APN	2	20806649	missense	probably benign	0.04
IGL01687:Etl4	APN	2	20530087	missense	probably damaging	1.00
IGL01793:Etl4	APN	2	20743898	missense	possibly damaging	0.87
IGL01844:Etl4	APN	2	20806682	missense	probably benign	0.06
IGL02025:Etl4	APN	2	20806526	missense	probably damaging	1.00
IGL02088:Etl4	APN	2	20806548	missense	probably damaging	1.00
IGL02134:Etl4	APN	2	20806429	missense	possibly damaging	0.79
IGL02369:Etl4	APN	2	20530189	missense	probably damaging	1.00
IGL02480:Etl4	APN	2	20788524	missense	probably damaging	0.99
IGL02560:Etl4	APN	2	20743718	missense	probably damaging	1.00
IGL02851:Etl4	APN	2	20808029	missense	possibly damaging	0.46
IGL02893:Etl4	APN	2	20760210	splice site	probably benign
IGL02951:Etl4	APN	2	20801537	splice site	probably benign
IGL03119:Etl4	APN	2	20713387	missense	probably damaging	1.00
IGL03267:Etl4	APN	2	20785182	nonsense	probably null
IGL03379:Etl4	APN	2	20662016	missense	possibly damaging	0.87
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0095:Etl4	UTSW	2	20743868	missense	probably damaging	1.00
R0100:Etl4	UTSW	2	20339905	missense	probably benign
R0311:Etl4	UTSW	2	20807129	missense	probably damaging	1.00
R0346:Etl4	UTSW	2	20759652	critical splice donor site	probably null
R0348:Etl4	UTSW	2	20778129	missense	probably damaging	1.00
R0379:Etl4	UTSW	2	20807354	missense	probably damaging	0.98
R0571:Etl4	UTSW	2	20743769	missense	probably damaging	0.99
R0697:Etl4	UTSW	2	20743861	missense	probably damaging	1.00
R0707:Etl4	UTSW	2	20805571	splice site	probably benign
R0980:Etl4	UTSW	2	20801567	missense	probably damaging	1.00
R1120:Etl4	UTSW	2	20806703	missense	probably benign	0.00
R1254:Etl4	UTSW	2	20807923	missense	probably damaging	1.00
R1346:Etl4	UTSW	2	20806144	missense	possibly damaging	0.94
R1460:Etl4	UTSW	2	20788477	missense	probably damaging	1.00
R1503:Etl4	UTSW	2	20743874	missense	possibly damaging	0.94
R1547:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R1627:Etl4	UTSW	2	20801579	missense	possibly damaging	0.91
R1635:Etl4	UTSW	2	20806408	missense	probably damaging	1.00
R1716:Etl4	UTSW	2	20743681	missense	probably damaging	1.00
R1795:Etl4	UTSW	2	20808026	critical splice donor site	probably null
R1885:Etl4	UTSW	2	20743984	missense	probably damaging	1.00
R2039:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R2083:Etl4	UTSW	2	20743549	missense	probably damaging	1.00
R2109:Etl4	UTSW	2	20785342	missense	probably benign	0.27
R2153:Etl4	UTSW	2	20798734	missense	probably benign	0.00
R2403:Etl4	UTSW	2	20807306	nonsense	probably null
R2883:Etl4	UTSW	2	20806174	missense	possibly damaging	0.83
R2985:Etl4	UTSW	2	20781849	missense	probably damaging	1.00
R3402:Etl4	UTSW	2	20781882	missense	probably damaging	1.00
R3696:Etl4	UTSW	2	20801662	critical splice donor site	probably null
R3755:Etl4	UTSW	2	20743537	missense	probably benign	0.10
R3813:Etl4	UTSW	2	20788435	missense	probably damaging	1.00
R3829:Etl4	UTSW	2	20785421	missense	probably benign	0.07
R3887:Etl4	UTSW	2	20529961	nonsense	probably null
R3888:Etl4	UTSW	2	20529961	nonsense	probably null
R3889:Etl4	UTSW	2	20529961	nonsense	probably null
R3958:Etl4	UTSW	2	20340043	missense	probably benign
R3959:Etl4	UTSW	2	20340043	missense	probably benign
R3960:Etl4	UTSW	2	20340043	missense	probably benign
R4058:Etl4	UTSW	2	20806019	missense	possibly damaging	0.59
R4074:Etl4	UTSW	2	20809219	utr 3 prime	probably benign
R4077:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4078:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4127:Etl4	UTSW	2	20744075	missense	possibly damaging	0.93
R4200:Etl4	UTSW	2	20781883	missense	probably damaging	1.00
R4492:Etl4	UTSW	2	20806865	missense	possibly damaging	0.67
R4514:Etl4	UTSW	2	20661898	missense	probably damaging	1.00
R4820:Etl4	UTSW	2	20806685	missense	possibly damaging	0.85
R4825:Etl4	UTSW	2	20806927	missense	probably damaging	1.00
R4888:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R4938:Etl4	UTSW	2	20798649	missense	probably benign	0.00
R4943:Etl4	UTSW	2	20807281	missense	probably benign	0.05
R5121:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R5191:Etl4	UTSW	2	20339999	missense	probably damaging	0.99
R5198:Etl4	UTSW	2	20713387	missense	probably damaging	1.00
R5199:Etl4	UTSW	2	20744042	missense	probably damaging	1.00
R5470:Etl4	UTSW	2	20529980	missense	probably damaging	0.99
R5513:Etl4	UTSW	2	20743827	missense	probably damaging	1.00
R5620:Etl4	UTSW	2	20530226	missense	probably damaging	1.00
R5635:Etl4	UTSW	2	20807035	missense	probably damaging	1.00
R5641:Etl4	UTSW	2	20806462	frame shift	probably null
R5690:Etl4	UTSW	2	20805836	missense	probably benign	0.01
R5784:Etl4	UTSW	2	20806205	missense	possibly damaging	0.79
R5794:Etl4	UTSW	2	20806512	missense	probably damaging	1.00
R5908:Etl4	UTSW	2	20743907	missense	probably damaging	0.96
R5982:Etl4	UTSW	2	20781015	missense	probably damaging	1.00
R6151:Etl4	UTSW	2	20713360	missense	probably damaging	1.00
R6192:Etl4	UTSW	2	20801551	missense	probably damaging	0.98
R6238:Etl4	UTSW	2	20801568	missense	probably damaging	1.00
R6248:Etl4	UTSW	2	20809089	missense	possibly damaging	0.90
R6292:Etl4	UTSW	2	20743573	missense	probably damaging	1.00
R6610:Etl4	UTSW	2	20713369	missense	probably damaging	1.00
R6739:Etl4	UTSW	2	20713435	missense	probably damaging	1.00
R6846:Etl4	UTSW	2	20744108	missense	possibly damaging	0.94
R6863:Etl4	UTSW	2	20806309	missense	probably benign	0.01
R6873:Etl4	UTSW	2	20797992	splice site	probably null
R7003:Etl4	UTSW	2	20805884	missense	probably benign	0.03
R7155:Etl4	UTSW	2	20806931	missense	probably damaging	0.96
R7207:Etl4	UTSW	2	20709576	missense	probably damaging	0.99
R7230:Etl4	UTSW	2	20797988	missense	probably damaging	1.00
R7305:Etl4	UTSW	2	20709557	missense	probably damaging	1.00
R7389:Etl4	UTSW	2	20785093	nonsense	probably null
R7396:Etl4	UTSW	2	20798638	missense	possibly damaging	0.62
R7441:Etl4	UTSW	2	20744189	missense	possibly damaging	0.87
R7626:Etl4	UTSW	2	20713378	missense	probably damaging	1.00
R7776:Etl4	UTSW	2	20807146	missense	probably damaging	0.99
R7779:Etl4	UTSW	2	20709477	missense	probably damaging	1.00
R7798:Etl4	UTSW	2	20781946	critical splice donor site	probably null
R7851:Etl4	UTSW	2	20744140	missense	probably damaging	1.00
R7861:Etl4	UTSW	2	20805910	missense	probably benign
R7901:Etl4	UTSW	2	20290010	missense	possibly damaging	0.83
R8053:Etl4	UTSW	2	20661963	missense	probably damaging	1.00
R8133:Etl4	UTSW	2	20806271	missense	possibly damaging	0.86
R8203:Etl4	UTSW	2	20785105	missense	possibly damaging	0.61
R8238:Etl4	UTSW	2	20806531	nonsense	probably null
R8263:Etl4	UTSW	2	20744154	missense	probably benign	0.00
R8299:Etl4	UTSW	2	20744063	missense	possibly damaging	0.81
R8318:Etl4	UTSW	2	20788530	missense	probably damaging	1.00
R8334:Etl4	UTSW	2	20781046	missense	probably damaging	0.96
R8443:Etl4	UTSW	2	20806166	missense	probably benign	0.04
R8525:Etl4	UTSW	2	20530081	missense	probably damaging	1.00
RF003:Etl4	UTSW	2	20519918	nonsense	probably null
X0018:Etl4	UTSW	2	20809190	missense	probably damaging	0.98
X0022:Etl4	UTSW	2	20709564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAACCGGTTGTGTGCCTG -3'
(R):5'- CTTGGGACTTTCAAACTGGTC -3'

Sequencing Primer
(F):5'- TTGTGTGCCTGGACAAGAAACC -3'
(R):5'- GGGACTTTCAAACTGGTCATCAAC -3'

Posted On

2020-06-30