Incidental Mutation 'R8202:Myl10'
ID635704
Institutional Source Beutler Lab
Gene Symbol Myl10
Ensembl Gene ENSMUSG00000005474
Gene Namemyosin, light chain 10, regulatory
SynonymsPLRLC-C, 1700027I08Rik, PLRLC, PLRLC-A, Mylc2pl, PLRLC-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136693146-136701094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 136697971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 70 (V70L)
Ref Sequence ENSEMBL: ENSMUSP00000143165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005611] [ENSMUST00000196068] [ENSMUST00000196436] [ENSMUST00000197186]
Predicted Effect probably benign
Transcript: ENSMUST00000005611
AA Change: V86L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005611
Gene: ENSMUSG00000005474
AA Change: V86L

DomainStartEndE-ValueType
EFh 9 37 1.5e-5 SMART
EFh 79 107 3.16e1 SMART
Blast:EFh 115 143 6e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196068
AA Change: K115N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142570
Gene: ENSMUSG00000005474
AA Change: K115N

DomainStartEndE-ValueType
Pfam:EF-hand_1 9 37 9.4e-7 PFAM
Pfam:EF-hand_6 9 40 9.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196436
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142495
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197186
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143165
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199074
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Myl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Myl10 APN 5 136697942 nonsense probably null
G1Funyon:Myl10 UTSW 5 136697971 missense probably benign 0.00
PIT4243001:Myl10 UTSW 5 136694293 missense probably benign 0.05
R4066:Myl10 UTSW 5 136695450 missense probably damaging 1.00
R5712:Myl10 UTSW 5 136694238 missense probably damaging 1.00
R6321:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6322:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6566:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6756:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6757:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6894:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7033:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7152:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7242:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7411:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7484:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7535:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7537:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7630:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7631:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7635:Myl10 UTSW 5 136700864 missense probably benign 0.00
R7764:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7829:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7969:Myl10 UTSW 5 136700853 critical splice acceptor site probably null
R8065:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8066:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8067:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8203:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8204:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8206:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8217:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8248:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8300:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8301:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8343:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8731:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8732:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8831:Myl10 UTSW 5 136697971 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGATGCAGCTGGAGTAGTTCC -3'
(R):5'- TATACCAGGAGGAACGGCTG -3'

Sequencing Primer
(F):5'- CTGCCTAGAATCTTCCAGTGAGG -3'
(R):5'- CAGGAGGAACGGCTGGTTTG -3'
Posted On2020-07-13