Incidental Mutation 'R8202:Zfp677'
ID 635738
Institutional Source Beutler Lab
Gene Symbol Zfp677
Ensembl Gene ENSMUSG00000062743
Gene Name zinc finger protein 677
Synonyms A830058L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R8202 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21383748-21399265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21393273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 43 (L43S)
Ref Sequence ENSEMBL: ENSMUSP00000052667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056107] [ENSMUST00000162659]
AlphaFold Q6PEP4
Predicted Effect probably damaging
Transcript: ENSMUST00000056107
AA Change: L43S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052667
Gene: ENSMUSG00000062743
AA Change: L43S

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162659
AA Change: L43S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125295
Gene: ENSMUSG00000062743
AA Change: L43S

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
Pfam:zf-H2C2_2 118 140 2.9e-5 PFAM
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Zfp677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfp677 APN 17 21397668 missense probably benign 0.33
IGL01973:Zfp677 APN 17 21396907 missense probably damaging 1.00
IGL02206:Zfp677 APN 17 21393237 missense probably damaging 1.00
IGL03240:Zfp677 APN 17 21396873 missense probably damaging 0.99
IGL03409:Zfp677 APN 17 21396845 missense probably damaging 1.00
R0622:Zfp677 UTSW 17 21397700 missense probably benign 0.04
R0972:Zfp677 UTSW 17 21398310 missense probably damaging 1.00
R1519:Zfp677 UTSW 17 21397237 missense possibly damaging 0.91
R2155:Zfp677 UTSW 17 21397708 missense probably benign 0.01
R2316:Zfp677 UTSW 17 21397320 missense probably benign 0.38
R2866:Zfp677 UTSW 17 21397256 nonsense probably null
R2989:Zfp677 UTSW 17 21396852 missense probably benign 0.11
R3955:Zfp677 UTSW 17 21397817 missense possibly damaging 0.95
R4075:Zfp677 UTSW 17 21398159 missense probably damaging 1.00
R4134:Zfp677 UTSW 17 21397781 missense probably benign 0.01
R4229:Zfp677 UTSW 17 21398282 missense probably damaging 1.00
R4729:Zfp677 UTSW 17 21397418 missense possibly damaging 0.51
R4843:Zfp677 UTSW 17 21392526 missense probably benign 0.23
R5023:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
R5316:Zfp677 UTSW 17 21397148 missense probably damaging 0.99
R5420:Zfp677 UTSW 17 21397913 missense probably damaging 1.00
R5694:Zfp677 UTSW 17 21397759 missense probably damaging 0.99
R5837:Zfp677 UTSW 17 21397386 missense probably damaging 1.00
R5888:Zfp677 UTSW 17 21398258 missense probably damaging 1.00
R6007:Zfp677 UTSW 17 21397656 missense probably damaging 1.00
R6119:Zfp677 UTSW 17 21397808 missense possibly damaging 0.55
R6190:Zfp677 UTSW 17 21397268 missense possibly damaging 0.91
R6518:Zfp677 UTSW 17 21398130 missense probably damaging 1.00
R7198:Zfp677 UTSW 17 21398417 missense probably damaging 1.00
R7391:Zfp677 UTSW 17 21398391 missense possibly damaging 0.56
R7801:Zfp677 UTSW 17 21398015 missense probably damaging 1.00
R7808:Zfp677 UTSW 17 21397385 missense probably damaging 1.00
R8206:Zfp677 UTSW 17 21392455 splice site probably null
R8885:Zfp677 UTSW 17 21398088 missense probably benign
R8965:Zfp677 UTSW 17 21396893 missense probably damaging 1.00
R9062:Zfp677 UTSW 17 21392553 critical splice donor site probably null
R9167:Zfp677 UTSW 17 21393198 missense probably damaging 1.00
R9371:Zfp677 UTSW 17 21397791 missense probably damaging 1.00
R9638:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
RF003:Zfp677 UTSW 17 21397442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGCAGAGTCTGTGAAACAG -3'
(R):5'- TGTGACACCTATAAATGAAAGATGG -3'

Sequencing Primer
(F):5'- ATTACCTTTTGAGTATTGTCCTTGC -3'
(R):5'- TGAAAGATGGAAAGAAAAACACCC -3'
Posted On 2020-07-13