Mutagenetix > Incidental Mutation

Incidental Mutation 'R0048:Raph1'

64239

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

038342-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R0048 (G1)

Quality Score

111

Status

Validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60500605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 423 (K423E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]

AlphaFold

F2Z3U3

Predicted Effect

probably benign
Transcript: ENSMUST00000027168
AA Change: K423E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: K423E

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090293
AA Change: K423E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: K423E

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127573
AA Change: K423E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000114596
Gene: ENSMUSG00000026014
AA Change: K423E

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
coiled coil region	295	320	N/A	INTRINSIC
RA	322	408	1e-15	SMART
PH	450	560	1.6e-13	SMART
low complexity region	581	604	N/A	INTRINSIC
low complexity region	656	661	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: K371E

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: K371E

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189383

Meta Mutation Damage Score

0.0618

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.3%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	A	G	1: 25,101,482	I299T	probably benign	Het
Ankrd12	A	G	17: 65,984,803	S1212P	probably damaging	Het
Ankrd50	A	G	3: 38,483,049	S52P	probably benign	Het
Brca1	A	G	11: 101,524,977	V777A	possibly damaging	Het
Dppa2	A	G	16: 48,317,398	M248V	probably benign	Het
Fat2	G	T	11: 55,310,039	H736Q	probably benign	Het
Fgfr2	A	T	7: 130,180,488		probably benign	Het
Gif	G	A	19: 11,749,756	V110M	possibly damaging	Het
Hmcn2	T	C	2: 31,428,237	S3865P	possibly damaging	Het
Iqgap3	A	T	3: 88,115,949	T516S	probably benign	Het
Itpr2	T	C	6: 146,232,291		probably null	Het
Lrrfip1	C	T	1: 91,093,647		probably benign	Het
Mfsd12	G	A	10: 81,362,814	V380I	possibly damaging	Het
Mroh9	G	A	1: 163,062,487	T227M	probably damaging	Het
Mtor	C	T	4: 148,538,881	Q2063*	probably null	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Olfr273	C	A	4: 52,856,196	A106S	probably damaging	Het
Ptgfr	A	G	3: 151,835,091	V260A	possibly damaging	Het
Rbm27	A	G	18: 42,298,464	D112G	probably benign	Het
Ryr2	T	C	13: 11,595,784	E4052G	probably damaging	Het
Sart3	G	T	5: 113,755,397	D346E	possibly damaging	Het
Siglec1	T	C	2: 131,073,397	T1425A	possibly damaging	Het
Snx25	A	T	8: 46,105,109		probably benign	Het
Son	T	A	16: 91,658,977	H1537Q	possibly damaging	Het
Tgfb1	T	A	7: 25,694,354		probably benign	Het
Umodl1	A	T	17: 30,968,477	N172Y	probably damaging	Het
Urah	C	T	7: 140,836,752	T46I	probably damaging	Het
Usp8	C	T	2: 126,737,889	P353L	probably damaging	Het
Vamp2	A	G	11: 69,089,759	D51G	possibly damaging	Het
Vmn1r67	G	A	7: 10,446,866	G19E	probably damaging	Het
Wdr76	C	T	2: 121,535,419		probably benign	Het
Wwox	C	A	8: 114,439,830	P20Q	probably damaging	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCATTGCTCTTTTAAATGCACTGGAC -3'
(R):5'- CATAGCAAGTGTTTTGGGCAAGATGG -3'

Sequencing Primer
(F):5'- CACTGGACTGACTATTGTTTAGC -3'
(R):5'- TGATGATACTCTTCAGAGGGAGC -3'

Posted On

2013-08-06