Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Foxa3'

644251

Institutional Source

Beutler Lab

Gene Symbol

Foxa3

Ensembl Gene

ENSMUSG00000040891

Gene Name

forkhead box A3

Synonyms

Tcf-3g, Hnf3g, Tcf3g, Hnf-3g

MMRRC Submission

067859-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18747209-18757463 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18748109 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 339 (V339A)

Ref Sequence

ENSEMBL: ENSMUSP00000043173 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036018]

AlphaFold

P35584

Predicted Effect

probably benign
Transcript: ENSMUST00000036018
AA Change: V339A

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043173
Gene: ENSMUSG00000040891
AA Change: V339A

Domain	Start	End	E-Value	Type
low complexity region	59	93	N/A	INTRINSIC
FH	117	207	5.48e-62	SMART
low complexity region	226	267	N/A	INTRINSIC
Pfam:HNF_C	304	332	1.9e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. The crystal structure of a similar protein in rat has been resolved. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expression of several liver-specific and liver-enriched genes, but appear to be phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,461,978 (GRCm39)		probably null	Het
Ackr4	A	G	9: 103,976,660 (GRCm39)	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376 (GRCm39)	I596T	possibly damaging	Het
Aff3	G	A	1: 38,244,135 (GRCm39)	R879W	probably benign	Het
Apob	A	G	12: 8,061,135 (GRCm39)	R3206G	probably damaging	Het
Atg7	T	A	6: 114,663,057 (GRCm39)	D224E	possibly damaging	Het
Capn12	T	C	7: 28,582,626 (GRCm39)	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,233,848 (GRCm39)	V224G	probably damaging	Het
Ces4a	G	A	8: 105,874,714 (GRCm39)	V452I	probably damaging	Het
Cherp	G	A	8: 73,215,852 (GRCm39)	R834C		Het
Clptm1l	T	A	13: 73,760,547 (GRCm39)	I310N	probably damaging	Het
Cog3	A	T	14: 75,978,003 (GRCm39)	D230E	probably damaging	Het
Crb1	T	A	1: 139,165,005 (GRCm39)	I1101F	probably damaging	Het
Cts6	A	T	13: 61,343,282 (GRCm39)	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,174,906 (GRCm39)	C435*	probably null	Het
Defb13	A	G	8: 22,438,562 (GRCm39)	E40G	probably benign	Het
Dis3l	T	C	9: 64,219,112 (GRCm39)	D606G	possibly damaging	Het
Dop1b	T	C	16: 93,568,675 (GRCm39)	L1579P	probably damaging	Het
Gcn1	G	A	5: 115,747,921 (GRCm39)	G1776E	probably damaging	Het
Gls2	A	G	10: 128,037,154 (GRCm39)	T232A	probably benign	Het
Gprc6a	A	T	10: 51,503,355 (GRCm39)	Y169*	probably null	Het
Guca2b	T	C	4: 119,516,001 (GRCm39)	S18G	unknown	Het
Hars2	A	G	18: 36,922,288 (GRCm39)	D301G	possibly damaging	Het
Haus5	T	A	7: 30,358,984 (GRCm39)	Q226L	possibly damaging	Het
Hc	G	A	2: 34,902,910 (GRCm39)		probably null	Het
Hivep2	T	C	10: 14,004,011 (GRCm39)	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,899,543 (GRCm39)	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,498,661 (GRCm39)	R3L	probably benign	Het
Hspa8	T	G	9: 40,713,897 (GRCm39)	I130S	probably damaging	Het
Ier5l	C	A	2: 30,362,861 (GRCm39)	C388F	possibly damaging	Het
Ldc1	C	T	4: 130,109,156 (GRCm39)	V295M	possibly damaging	Het
Lmx1a	A	G	1: 167,517,372 (GRCm39)	N10S	probably benign	Het
Map2	T	C	1: 66,454,272 (GRCm39)	I1054T	probably benign	Het
Me1	C	T	9: 86,501,790 (GRCm39)	D268N	probably damaging	Het
Muc6	G	A	7: 141,226,525 (GRCm39)	P1501S	unknown	Het
Myo1d	T	C	11: 80,528,900 (GRCm39)	M641V	probably benign	Het
Nuggc	G	A	14: 65,878,731 (GRCm39)	R667K	probably benign	Het
Oprl1	T	A	2: 181,360,717 (GRCm39)	C231S	probably damaging	Het
Or11g26	T	C	14: 50,753,015 (GRCm39)	F118S	probably damaging	Het
Or13p10	A	C	4: 118,523,604 (GRCm39)	N297H	probably damaging	Het
Pard3b	C	A	1: 62,676,957 (GRCm39)	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,017,283 (GRCm39)	Y158C	probably damaging	Het
Prune2	T	G	19: 17,098,629 (GRCm39)	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,712,110 (GRCm39)	T158K	probably damaging	Het
Rbm42	T	A	7: 30,344,582 (GRCm39)	E227V	unknown	Het
Ripor3	T	C	2: 167,825,119 (GRCm39)	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,492,855 (GRCm39)	H3764L	possibly damaging	Het
Sbno2	T	C	10: 79,900,221 (GRCm39)	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,365,030 (GRCm39)	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,039,409 (GRCm39)	L73P	probably damaging	Het
Spag16	T	C	1: 69,934,407 (GRCm39)	I278T	probably benign	Het
Stx18	T	A	5: 38,285,450 (GRCm39)	L274*	probably null	Het
Terb1	A	T	8: 105,211,003 (GRCm39)	N341K	probably damaging	Het
Timm29	A	G	9: 21,505,001 (GRCm39)	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,369,665 (GRCm39)	M370L	probably benign	Het
Tmtc3	T	A	10: 100,283,296 (GRCm39)	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,832 (GRCm39)	C699*	probably null	Het
Trav5d-4	G	A	14: 53,239,208 (GRCm39)	W13*	probably null	Het
Trdn	A	G	10: 33,320,074 (GRCm39)		probably null	Het
Tsg101	A	T	7: 46,558,808 (GRCm39)	Y68N	probably damaging	Het
Ttn	A	G	2: 76,664,062 (GRCm39)	V11649A	unknown	Het
Wnk2	A	T	13: 49,248,914 (GRCm39)	V379D	probably damaging	Het
Xpnpep1	A	G	19: 52,990,903 (GRCm39)		probably null	Het
Yme1l1	C	T	2: 23,054,597 (GRCm39)	Q139*	probably null	Het

Other mutations in Foxa3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01823:Foxa3	APN	7	18,748,443 (GRCm39)	missense	probably benign
R0378:Foxa3	UTSW	7	18,757,294 (GRCm39)	missense	probably damaging	1.00
R1833:Foxa3	UTSW	7	18,748,499 (GRCm39)	missense	probably damaging	1.00
R2159:Foxa3	UTSW	7	18,748,109 (GRCm39)	missense	probably benign	0.40
R2877:Foxa3	UTSW	7	18,748,805 (GRCm39)	missense	probably benign	0.38
R4666:Foxa3	UTSW	7	18,748,297 (GRCm39)	nonsense	probably null
R5533:Foxa3	UTSW	7	18,748,940 (GRCm39)	nonsense	probably null
R5669:Foxa3	UTSW	7	18,748,176 (GRCm39)	missense	probably benign	0.41
R7339:Foxa3	UTSW	7	18,748,794 (GRCm39)	missense	probably damaging	1.00
R8128:Foxa3	UTSW	7	18,757,341 (GRCm39)	start codon destroyed	probably null	0.77
R9232:Foxa3	UTSW	7	18,748,790 (GRCm39)	missense	probably damaging	1.00
R9305:Foxa3	UTSW	7	18,748,961 (GRCm39)	missense	possibly damaging	0.82
R9627:Foxa3	UTSW	7	18,748,458 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCACTTCCAAACGCATCTGC -3'
(R):5'- ACACCTTATTTCAGCGGCCTG -3'

Sequencing Primer
(F):5'- GTCCATGGCAGTTACCACAGTAG -3'
(R):5'- TATTTCAGCGGCCTGGAGCTC -3'

Posted On

2020-09-02