Incidental Mutation 'R8329:Hivep2'
ID 644268
Institutional Source Beutler Lab
Gene Symbol Hivep2
Ensembl Gene ENSMUSG00000015501
Gene Name human immunodeficiency virus type I enhancer binding protein 2
Synonyms Gm20114, Shn-2, Schnurri-2, MIBP1
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.936) question?
Stock # R8329 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 13841819-14027118 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14004011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000015645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015645] [ENSMUST00000186989] [ENSMUST00000187083] [ENSMUST00000191138]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000015645
AA Change: V203A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015645
Gene: ENSMUSG00000015501
AA Change: V203A

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186989
AA Change: V203A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140180
Gene: ENSMUSG00000015501
AA Change: V203A

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 7.9e-6 SMART
ZnF_C2H2 217 239 3.1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187083
AA Change: V203A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140290
Gene: ENSMUSG00000015501
AA Change: V203A

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191138
AA Change: V203A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140150
Gene: ENSMUSG00000015501
AA Change: V203A

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of closely related, large, zinc finger-containing transcription factors. The encoded protein regulates transcription by binding to regulatory regions of various cellular and viral genes that maybe involved in growth, development and metastasis. The protein contains the ZAS domain comprised of two widely separated regions of zinc finger motifs, a stretch of highly acidic amino acids and a serine/threonine-rich sequence. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal thymus anatomy, severely defective positive selection of CD4+ and CD8+ cells, and enhanced T-helper 2 cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Atg7 T A 6: 114,663,057 (GRCm39) D224E possibly damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gcn1 G A 5: 115,747,921 (GRCm39) G1776E probably damaging Het
Gls2 A G 10: 128,037,154 (GRCm39) T232A probably benign Het
Gprc6a A T 10: 51,503,355 (GRCm39) Y169* probably null Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hc G A 2: 34,902,910 (GRCm39) probably null Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ripor3 T C 2: 167,825,119 (GRCm39) R797G possibly damaging Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Slc36a3 A G 11: 55,039,409 (GRCm39) L73P probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Hivep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Hivep2 APN 10 14,017,988 (GRCm39) missense probably damaging 1.00
IGL00963:Hivep2 APN 10 14,005,091 (GRCm39) missense probably damaging 1.00
IGL01066:Hivep2 APN 10 14,024,768 (GRCm39) missense possibly damaging 0.92
IGL01395:Hivep2 APN 10 14,008,544 (GRCm39) critical splice donor site probably null
IGL01474:Hivep2 APN 10 14,019,406 (GRCm39) missense probably damaging 1.00
IGL01481:Hivep2 APN 10 14,024,981 (GRCm39) missense probably benign
IGL01597:Hivep2 APN 10 14,025,118 (GRCm39) nonsense probably null
IGL01719:Hivep2 APN 10 14,006,267 (GRCm39) missense probably damaging 1.00
IGL01952:Hivep2 APN 10 14,018,075 (GRCm39) missense possibly damaging 0.54
IGL02170:Hivep2 APN 10 14,003,548 (GRCm39) missense possibly damaging 0.46
IGL02315:Hivep2 APN 10 14,006,983 (GRCm39) missense probably benign 0.01
IGL02517:Hivep2 APN 10 14,006,926 (GRCm39) missense probably benign 0.01
IGL02535:Hivep2 APN 10 14,015,241 (GRCm39) missense probably damaging 1.00
IGL02539:Hivep2 APN 10 14,007,622 (GRCm39) missense probably damaging 0.97
IGL02637:Hivep2 APN 10 14,006,452 (GRCm39) missense possibly damaging 0.89
IGL02715:Hivep2 APN 10 14,007,131 (GRCm39) missense probably benign 0.03
IGL02948:Hivep2 APN 10 14,004,757 (GRCm39) missense probably benign 0.44
IGL03113:Hivep2 APN 10 14,006,395 (GRCm39) missense probably damaging 1.00
IGL03161:Hivep2 APN 10 14,019,100 (GRCm39) missense probably damaging 1.00
IGL03173:Hivep2 APN 10 14,003,726 (GRCm39) missense possibly damaging 0.75
IGL03310:Hivep2 APN 10 14,019,411 (GRCm39) missense probably damaging 1.00
BB010:Hivep2 UTSW 10 14,003,581 (GRCm39) missense probably damaging 1.00
BB020:Hivep2 UTSW 10 14,003,581 (GRCm39) missense probably damaging 1.00
R0005:Hivep2 UTSW 10 14,004,493 (GRCm39) missense probably damaging 0.99
R0053:Hivep2 UTSW 10 14,007,865 (GRCm39) missense probably damaging 1.00
R0053:Hivep2 UTSW 10 14,007,865 (GRCm39) missense probably damaging 1.00
R0136:Hivep2 UTSW 10 14,007,622 (GRCm39) missense probably benign 0.04
R0143:Hivep2 UTSW 10 14,005,099 (GRCm39) missense probably damaging 1.00
R0172:Hivep2 UTSW 10 14,015,218 (GRCm39) missense probably damaging 1.00
R0226:Hivep2 UTSW 10 14,005,456 (GRCm39) missense probably benign 0.26
R0348:Hivep2 UTSW 10 14,005,702 (GRCm39) missense possibly damaging 0.76
R0352:Hivep2 UTSW 10 14,019,039 (GRCm39) missense possibly damaging 0.74
R0657:Hivep2 UTSW 10 14,007,622 (GRCm39) missense probably benign 0.04
R1710:Hivep2 UTSW 10 14,005,249 (GRCm39) nonsense probably null
R1959:Hivep2 UTSW 10 14,008,453 (GRCm39) missense probably benign 0.02
R2017:Hivep2 UTSW 10 14,006,501 (GRCm39) missense probably damaging 0.96
R2085:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2085:Hivep2 UTSW 10 14,015,273 (GRCm39) nonsense probably null
R2163:Hivep2 UTSW 10 14,003,970 (GRCm39) nonsense probably null
R2206:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2207:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2228:Hivep2 UTSW 10 14,004,107 (GRCm39) missense probably damaging 1.00
R2241:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2242:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2243:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2246:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2247:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2273:Hivep2 UTSW 10 14,008,187 (GRCm39) missense probably benign 0.02
R2357:Hivep2 UTSW 10 14,019,043 (GRCm39) missense probably benign 0.01
R2517:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2519:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2858:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2859:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2916:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R2921:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3051:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3177:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3277:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3620:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3621:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3701:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3802:Hivep2 UTSW 10 14,024,705 (GRCm39) missense possibly damaging 0.94
R3810:Hivep2 UTSW 10 14,006,101 (GRCm39) missense probably benign
R3811:Hivep2 UTSW 10 14,006,101 (GRCm39) missense probably benign
R3817:Hivep2 UTSW 10 14,019,685 (GRCm39) missense possibly damaging 0.46
R3818:Hivep2 UTSW 10 14,019,685 (GRCm39) missense possibly damaging 0.46
R3819:Hivep2 UTSW 10 14,019,685 (GRCm39) missense possibly damaging 0.46
R3836:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3837:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3838:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3839:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3897:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3900:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3932:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3954:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R3957:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4001:Hivep2 UTSW 10 14,003,476 (GRCm39) missense probably damaging 1.00
R4134:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4180:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4248:Hivep2 UTSW 10 14,007,299 (GRCm39) missense probably damaging 1.00
R4416:Hivep2 UTSW 10 14,004,914 (GRCm39) missense probably benign
R4436:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4437:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4474:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4475:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4476:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4636:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4637:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4791:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4792:Hivep2 UTSW 10 14,004,713 (GRCm39) missense probably benign 0.16
R4825:Hivep2 UTSW 10 14,007,063 (GRCm39) missense possibly damaging 0.81
R4955:Hivep2 UTSW 10 14,006,702 (GRCm39) missense probably benign 0.44
R5094:Hivep2 UTSW 10 14,007,893 (GRCm39) missense probably benign
R5129:Hivep2 UTSW 10 14,006,608 (GRCm39) missense probably damaging 1.00
R5163:Hivep2 UTSW 10 14,015,169 (GRCm39) missense probably damaging 1.00
R5255:Hivep2 UTSW 10 14,007,011 (GRCm39) splice site probably null
R5330:Hivep2 UTSW 10 14,007,164 (GRCm39) missense probably damaging 1.00
R5341:Hivep2 UTSW 10 14,008,336 (GRCm39) missense possibly damaging 0.94
R5453:Hivep2 UTSW 10 14,003,972 (GRCm39) missense possibly damaging 0.78
R5513:Hivep2 UTSW 10 14,008,417 (GRCm39) nonsense probably null
R5535:Hivep2 UTSW 10 14,006,766 (GRCm39) missense probably benign 0.00
R5613:Hivep2 UTSW 10 14,015,239 (GRCm39) missense probably damaging 1.00
R5804:Hivep2 UTSW 10 14,009,519 (GRCm39) missense probably benign 0.01
R6074:Hivep2 UTSW 10 14,007,485 (GRCm39) missense probably benign 0.18
R6163:Hivep2 UTSW 10 14,005,736 (GRCm39) missense probably damaging 0.98
R6250:Hivep2 UTSW 10 14,007,503 (GRCm39) missense probably benign 0.01
R6696:Hivep2 UTSW 10 14,009,503 (GRCm39) missense probably benign 0.06
R6754:Hivep2 UTSW 10 14,005,382 (GRCm39) missense probably benign 0.06
R6756:Hivep2 UTSW 10 14,008,303 (GRCm39) missense probably damaging 1.00
R6799:Hivep2 UTSW 10 14,004,757 (GRCm39) missense probably benign 0.28
R6862:Hivep2 UTSW 10 14,006,327 (GRCm39) missense probably damaging 1.00
R6932:Hivep2 UTSW 10 14,004,245 (GRCm39) missense probably damaging 1.00
R6943:Hivep2 UTSW 10 14,004,058 (GRCm39) missense probably damaging 1.00
R7027:Hivep2 UTSW 10 14,025,322 (GRCm39) missense probably damaging 1.00
R7027:Hivep2 UTSW 10 14,025,321 (GRCm39) missense probably damaging 0.99
R7198:Hivep2 UTSW 10 14,005,710 (GRCm39) missense probably benign
R7248:Hivep2 UTSW 10 14,006,909 (GRCm39) missense possibly damaging 0.86
R7256:Hivep2 UTSW 10 14,004,845 (GRCm39) missense probably benign 0.29
R7426:Hivep2 UTSW 10 14,007,061 (GRCm39) missense possibly damaging 0.93
R7427:Hivep2 UTSW 10 14,009,485 (GRCm39) missense possibly damaging 0.94
R7638:Hivep2 UTSW 10 14,019,595 (GRCm39) missense possibly damaging 0.81
R7731:Hivep2 UTSW 10 14,025,458 (GRCm39) missense probably benign
R7740:Hivep2 UTSW 10 14,003,414 (GRCm39) missense probably damaging 1.00
R7797:Hivep2 UTSW 10 14,005,847 (GRCm39) missense probably benign
R7933:Hivep2 UTSW 10 14,003,581 (GRCm39) missense probably damaging 1.00
R8399:Hivep2 UTSW 10 14,008,178 (GRCm39) missense possibly damaging 0.63
R8767:Hivep2 UTSW 10 14,004,992 (GRCm39) missense probably damaging 1.00
R8802:Hivep2 UTSW 10 14,015,166 (GRCm39) missense probably damaging 1.00
R9002:Hivep2 UTSW 10 14,008,157 (GRCm39) missense probably benign 0.02
R9088:Hivep2 UTSW 10 14,006,995 (GRCm39) missense probably damaging 1.00
R9137:Hivep2 UTSW 10 14,004,712 (GRCm39) missense probably benign
R9198:Hivep2 UTSW 10 14,005,621 (GRCm39) missense probably benign 0.06
R9338:Hivep2 UTSW 10 14,004,693 (GRCm39) nonsense probably null
R9408:Hivep2 UTSW 10 14,007,505 (GRCm39) missense probably damaging 1.00
R9514:Hivep2 UTSW 10 14,005,523 (GRCm39) missense probably benign 0.34
R9516:Hivep2 UTSW 10 14,005,523 (GRCm39) missense probably benign 0.34
R9591:Hivep2 UTSW 10 14,019,640 (GRCm39) missense probably damaging 0.96
R9623:Hivep2 UTSW 10 14,006,546 (GRCm39) missense probably damaging 1.00
R9710:Hivep2 UTSW 10 14,015,203 (GRCm39) missense probably damaging 1.00
R9738:Hivep2 UTSW 10 14,019,583 (GRCm39) missense probably damaging 1.00
R9781:Hivep2 UTSW 10 14,005,828 (GRCm39) missense probably benign
Z1177:Hivep2 UTSW 10 14,019,051 (GRCm39) missense probably damaging 0.98
Z1177:Hivep2 UTSW 10 14,007,530 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCCAATGCACGGCCAC -3'
(R):5'- CTGAGTGGATCTCTGCTTCTACATC -3'

Sequencing Primer
(F):5'- CACAGCGGTGGTTATCCTAG -3'
(R):5'- ACCAGCCTCGAGGTCCAATTTG -3'
Posted On 2020-09-02