Mutagenetix > Incidental Mutations

Incidental Mutation 'R7950:Filip1l'

List |< first << previous [record 18 of 45] next >> last >|

649523

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7950 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57569711 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 221 (K221E)

Ref Sequence

ENSEMBL: ENSMUSP00000124179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159414

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159816
AA Change: K221E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: K221E

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,979,767	T31I	probably damaging	Het
Adgrf5	G	A	17: 43,451,157	V1248M	probably damaging	Het
Alb	T	C	5: 90,472,464	S478P	probably damaging	Het
Arhgap17	A	G	7: 123,286,816	S698P	probably benign	Het
Arhgef5	A	G	6: 43,273,925	T537A	possibly damaging	Het
Arl6	A	T	16: 59,618,731		probably null	Het
Atp13a4	A	T	16: 29,449,917	W540R		Het
Birc6	A	T	17: 74,593,100	D1091V	probably damaging	Het
Bnc1	A	G	7: 81,973,502	V659A	probably benign	Het
C130074G19Rik	T	C	1: 184,874,374		probably null	Het
C1ql4	T	A	15: 99,084,812	H220L	probably benign	Het
Cacna1s	A	G	1: 136,100,625	N1147S	probably benign	Het
Cc2d2a	T	C	5: 43,695,296		probably null	Het
Ccdc36	T	C	9: 108,405,671	T273A	probably benign	Het
Ccl1	T	A	11: 82,179,693	I18L	probably benign	Het
Ecel1	A	T	1: 87,148,269	Y729N	probably damaging	Het
Epha4	T	A	1: 77,507,196	I59F	probably damaging	Het
Flnc	A	G	6: 29,456,382	E2193G	possibly damaging	Het
Galnt10	C	G	11: 57,783,723	P513A	probably damaging	Het
Gm5624	A	G	14: 44,560,733	Y139H		Het
Golgb1	A	C	16: 36,915,424	I1719L	probably benign	Het
Hsf1	T	C	15: 76,498,193	S255P	probably benign	Het
Ighv2-2	T	C	12: 113,588,294	D108G	probably damaging	Het
Kbtbd3	C	T	9: 4,316,878	Q10*	probably null	Het
Kcnh2	C	T	5: 24,333,036	V110M	probably benign	Het
Magi3	A	C	3: 104,016,689	L1112W	probably damaging	Het
Malrd1	T	A	2: 16,128,068	D1933E	unknown	Het
Mki67	G	A	7: 135,699,724	R1194*	probably null	Het
Nap1l1	T	C	10: 111,492,908	Y233H	probably damaging	Het
Napsa	A	G	7: 44,585,334	I298V	probably benign	Het
Nkx6-1	A	T	5: 101,663,599	S212R	probably damaging	Het
Nlrc4	A	T	17: 74,445,615	I591N	probably damaging	Het
Olfr1468-ps1	T	C	19: 13,375,067	I35T	possibly damaging	Het
Orc2	T	C	1: 58,467,668	D503G	possibly damaging	Het
Osbp	T	A	19: 11,978,248	S343T	probably benign	Het
Pcdha6	T	G	18: 36,969,426	D557E	probably damaging	Het
Pdcd11	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	19: 47,113,437		probably benign	Het
Ppdpf	A	G	2: 181,187,857	Y35C	probably benign	Het
Scrn2	T	A	11: 97,030,929	L75Q	probably damaging	Het
Scube3	G	A	17: 28,171,226	V955I	probably benign	Het
Slc1a1	T	C	19: 28,911,761	V478A	probably benign	Het
Slc4a4	A	G	5: 89,058,278		probably null	Het
Srrm2	T	C	17: 23,808,110	L96P	unknown	Het
Strn	A	T	17: 78,670,423	L175Q		Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTAACGGTGACCTTGAAC -3'
(R):5'- AAACTCTGTGGTCTGTGTCTGC -3'

Sequencing Primer
(F):5'- ACGGTGACCTTGAACTGTTAC -3'
(R):5'- TCCTGAGCTCTGGCCTCAG -3'

Posted On

2020-09-15