Mutagenetix > Incidental Mutations

Incidental Mutation 'R8508:Slc22a12'

655732

Institutional Source

Beutler Lab

Gene Symbol

Slc22a12

Ensembl Gene

ENSMUSG00000061742

Gene Name

solute carrier family 22 (organic anion/cation transporter), member 12

Synonyms

Rst, URAT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

6535845-6543019 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6542437 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 106 (T106A)

Ref Sequence

ENSEMBL: ENSMUSP00000109078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113451] [ENSMUST00000113459]

Predicted Effect

probably benign
Transcript: ENSMUST00000113451
AA Change: T106A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742
AA Change: T106A

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	95	525	2e-26	PFAM
Pfam:MFS_1	128	484	7.5e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113459

SMART Domains

Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

Domain	Start	End	E-Value	Type
signal peptide	1	46	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
LamG	111	238	1.26e-19	SMART
low complexity region	267	297	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126142
AA Change: T92A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000114626
Gene: ENSMUSG00000061742
AA Change: T92A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
transmembrane domain	229	248	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary urate levels and altered urine and plasma metabolite composition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,598	L136P	probably benign	Het
4932438H23Rik	T	G	16: 91,055,612	Y212S	probably damaging	Het
Angpt1	T	C	15: 42,512,399	N154D	probably damaging	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ankrd27	T	A	7: 35,601,626	L117*	probably null	Het
Arhgap21	C	T	2: 20,854,180	M1234I	probably benign	Het
Arhgef33	A	G	17: 80,367,335	E387G	probably damaging	Het
Atp13a4	T	A	16: 29,454,769	K444*	probably null	Het
Atp6v1a	G	A	16: 44,101,862	R338C	probably damaging	Het
Canx	T	C	11: 50,311,647	D44G	possibly damaging	Het
Ccdc141	T	A	2: 77,132,244	M119L	probably benign	Het
Ckmt1	A	C	2: 121,362,691	Q299P	possibly damaging	Het
Dhx16	T	C	17: 35,885,920	S601P	probably damaging	Het
Dna2	A	C	10: 62,950,894	R140S	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Eogt	A	G	6: 97,143,998	S85P	possibly damaging	Het
Fbf1	A	T	11: 116,165,881	M1K	probably null	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Flnb	G	A	14: 7,950,394	V2571I	probably damaging	Het
Gm11361	A	G	13: 28,257,711	I26V	probably benign	Het
Gm43518	A	G	5: 123,938,259	E123G	unknown	Het
Gm8332	T	G	12: 88,249,685	E139A	unknown	Het
Gpatch2	A	G	1: 187,304,355	N374S	probably benign	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hoxa11	T	C	6: 52,245,802		probably benign	Het
Hydin	G	A	8: 110,582,018	V3979I	probably benign	Het
Ighe	C	T	12: 113,271,793	W277*	probably null	Het
Kmt2c	G	T	5: 25,314,122	T2330K	probably benign	Het
Krt6a	T	A	15: 101,692,735	K261M	probably damaging	Het
Lats2	A	C	14: 57,722,705	S161A	probably benign	Het
Med13l	T	A	5: 118,754,321	D1936E	probably benign	Het
Mipol1	T	C	12: 57,306,088	V71A	possibly damaging	Het
Mphosph8	A	T	14: 56,676,546	K415*	probably null	Het
Npepps	A	G	11: 97,244,426		probably null	Het
Ntn4	A	T	10: 93,741,104	N545Y	possibly damaging	Het
Olfr1501	A	T	19: 13,838,402	M257K	possibly damaging	Het
Olfr164	T	C	16: 19,286,701	D14G	probably benign	Het
Olfr353	A	G	2: 36,890,354	S165P	probably damaging	Het
Olfr738	A	C	14: 50,413,675	M44L	probably benign	Het
Osbpl2	T	A	2: 180,155,343	V358E	possibly damaging	Het
Pdcd11	C	A	19: 47,119,806	P1204Q	probably damaging	Het
Pnliprp2	A	C	19: 58,763,374	S184R	probably damaging	Het
Ppm1g	G	T	5: 31,204,528	R373S	probably damaging	Het
Rnf130	A	G	11: 50,087,437	D275G	probably damaging	Het
Setd5	T	C	6: 113,121,087	S696P	probably damaging	Het
Sgip1	A	G	4: 102,915,071	Q219R	probably benign	Het
Slc1a2	T	C	2: 102,736,085		probably null	Het
Slc22a14	A	G	9: 119,180,585	L148P	probably damaging	Het
Slc2a9	A	T	5: 38,382,078	F375I	probably damaging	Het
Sorbs3	A	T	14: 70,202,947	D117E	probably benign	Het
Sphkap	G	A	1: 83,276,500	T1176I	probably damaging	Het
Supt16	A	T	14: 52,181,589	V193D	probably damaging	Het
Sytl3	A	G	17: 6,728,291	T362A	probably damaging	Het
Tctn1	T	A	5: 122,246,611	Q410L	probably benign	Het
Trbc2	T	C	6: 41,547,777	Y133H		Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Vmn2r120	A	G	17: 57,525,843	V112A	probably benign	Het
Zfp354b	A	T	11: 50,923,470	S209R	probably benign	Het
Zfp362	T	C	4: 128,774,606	H391R	probably damaging	Het

Other mutations in Slc22a12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02033:Slc22a12	APN	19	6537814	missense	probably benign	0.19
IGL02586:Slc22a12	APN	19	6540457	missense	probably benign	0.03
mutual	UTSW	19	6542653	nonsense	probably null
reinforcement	UTSW	19	6537169	missense	probably benign	0.03
R1353:Slc22a12	UTSW	19	6537782	missense	possibly damaging	0.66
R1757:Slc22a12	UTSW	19	6536731	splice site	probably null
R1816:Slc22a12	UTSW	19	6542653	nonsense	probably null
R2254:Slc22a12	UTSW	19	6542541	missense	possibly damaging	0.86
R4110:Slc22a12	UTSW	19	6540628	missense	probably damaging	1.00
R4125:Slc22a12	UTSW	19	6538788	missense	probably damaging	0.99
R4342:Slc22a12	UTSW	19	6541099	missense	probably benign	0.15
R4762:Slc22a12	UTSW	19	6538444	missense	probably benign	0.02
R4927:Slc22a12	UTSW	19	6537761	missense	probably benign	0.23
R5690:Slc22a12	UTSW	19	6536848	missense	probably benign	0.00
R5772:Slc22a12	UTSW	19	6540449	missense	possibly damaging	0.67
R5946:Slc22a12	UTSW	19	6537851	missense	probably damaging	1.00
R6137:Slc22a12	UTSW	19	6542724	missense	probably benign	0.07
R7740:Slc22a12	UTSW	19	6537169	missense	probably benign	0.03
R7978:Slc22a12	UTSW	19	6536908	missense	possibly damaging	0.84
R8028:Slc22a12	UTSW	19	6538439	missense	probably benign	0.15
X0062:Slc22a12	UTSW	19	6537127	missense	probably damaging	1.00
Z1088:Slc22a12	UTSW	19	6538463	missense	possibly damaging	0.54
Z1177:Slc22a12	UTSW	19	6540401	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGACCTTGCAGATGACTCCC -3'
(R):5'- GAACTTCTCAGCCGCAGTTC -3'

Sequencing Primer
(F):5'- GTCCCCTGCAAGCCTACATG -3'
(R):5'- AGTTCCCCACCACCGCTG -3'

Posted On

2020-10-20