Incidental Mutation 'R8710:Iqgap2'
ID669524
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8710 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 95660248 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 1133 (N1133H)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably benign
Transcript: ENSMUST00000068603
AA Change: N1133H

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: N1133H

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030025P20Rik A T 17: 14,988,932 N342I probably damaging Het
Abcb4 A G 5: 8,955,495 N1126S probably damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Agpat5 T A 8: 18,878,089 D223E possibly damaging Het
Anks3 A C 16: 4,958,112 Y75* probably null Het
Ano5 T G 7: 51,593,671 D847E probably damaging Het
Asb6 G T 2: 30,827,060 T51K probably benign Het
Bahcc1 A G 11: 120,284,127 E1702G probably damaging Het
Bend7 A G 2: 4,763,114 M294V probably benign Het
Cadm1 T A 9: 47,848,168 D392E probably damaging Het
Camkmt T C 17: 85,113,849 probably benign Het
Cd300a A G 11: 114,894,675 T149A probably benign Het
Cd69 A T 6: 129,269,610 W153R possibly damaging Het
Cdc25c T A 18: 34,749,613 probably benign Het
Clnk A C 5: 38,774,597 C40W possibly damaging Het
Cthrc1 T A 15: 39,084,426 L180Q probably damaging Het
Cyld A G 8: 88,709,895 N271S probably damaging Het
Dnah14 T C 1: 181,690,311 I2070T probably benign Het
Dnah17 A C 11: 118,042,147 L3595R probably damaging Het
Edrf1 A G 7: 133,643,766 Y211C probably damaging Het
Efcab6 A G 15: 84,018,648 I167T probably benign Het
Elavl3 A T 9: 22,026,553 Y148N probably damaging Het
Fam83c A G 2: 155,829,722 S598P probably benign Het
Gm38119 ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA 3: 92,737,890 probably benign Het
Helb A G 10: 120,105,967 L272P probably damaging Het
Iars2 A C 1: 185,295,586 V715G probably benign Het
Kifc5b T A 17: 26,920,906 M43K probably damaging Het
Krtap7-1 T A 16: 89,508,120 Y48F possibly damaging Het
Lag3 G A 6: 124,908,445 T324I probably damaging Het
Mapkapk2 C A 1: 131,058,711 A97S possibly damaging Het
Mettl4 A G 17: 94,733,644 S361P probably damaging Het
Myh4 A G 11: 67,252,332 T1029A probably benign Het
Nsl1 C A 1: 191,063,223 A62D probably benign Het
Oas1e T A 5: 120,791,962 K164* probably null Het
Obsl1 A G 1: 75,492,682 F1205S probably benign Het
Olfr113 G T 17: 37,574,649 A258E probably benign Het
Olfr1537 T A 9: 39,238,010 Y138F probably benign Het
Olfr22-ps1 G A 11: 73,954,868 M59I possibly damaging Het
Olfr893 C T 9: 38,209,770 A237V possibly damaging Het
Pald1 A G 10: 61,347,453 F334S probably benign Het
Pikfyve A G 1: 65,215,996 E325G possibly damaging Het
Plekha8 A G 6: 54,622,260 T215A probably benign Het
Ptprq T C 10: 107,576,058 R1816G possibly damaging Het
Ralgps1 G A 2: 33,145,421 L472F probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Rfx6 A G 10: 51,725,405 T607A probably damaging Het
Rtca A T 3: 116,497,654 Y226N probably benign Het
Sash1 T A 10: 8,780,521 N236Y possibly damaging Het
Skint11 A G 4: 114,194,754 I100V probably benign Het
Skint5 A T 4: 113,626,590 S948R unknown Het
Slc25a13 A T 6: 6,114,238 Y279N probably benign Het
Slc5a2 T C 7: 128,265,794 L33P probably damaging Het
Slco1a5 A T 6: 142,253,102 V279E probably benign Het
Ssh3 G T 19: 4,263,805 H475Q probably benign Het
Tjp2 T C 19: 24,095,432 E1166G probably damaging Het
Tll1 A G 8: 64,124,906 L89P possibly damaging Het
Tmc4 G T 7: 3,675,464 T123N probably benign Het
Tmem139 A G 6: 42,264,087 D202G probably damaging Het
Trim35 T C 14: 66,307,918 S313P probably damaging Het
Ttc23l A G 15: 10,539,935 I154T probably damaging Het
Ttc9c T C 19: 8,818,496 T60A probably benign Het
Wdfy3 G T 5: 101,882,483 N2386K probably damaging Het
Wdpcp C A 11: 21,660,924 Q49K probably benign Het
Xrn1 A T 9: 96,002,232 Y867F Het
Zfp423 C T 8: 87,780,921 E932K possibly damaging Het
Zfp592 T C 7: 81,023,573 F95S probably damaging Het
Zfp644 T G 5: 106,635,131 N1095H probably damaging Het
Zfp983 A T 17: 21,661,318 N54I probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCGGACAGACTATCATTCTTGTC -3'
(R):5'- CACTCCTGCAGAAAATGGAAATG -3'

Sequencing Primer
(F):5'- GACAGACTATCATTCTTGTCTGTCC -3'
(R):5'- GCAGATTGTTGGAAATCTCC -3'
Posted On2021-04-30