Incidental Mutation 'R8301:Iqgap2'
ID639281
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8301 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 95682151 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably null
Transcript: ENSMUST00000068603
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
R8845:Iqgap2 UTSW 13 95657884 missense possibly damaging 0.60
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CATCATTACTAAGGCAGTCCCC -3'
(R):5'- TCCTTTCACCCGATGTGTGG -3'

Sequencing Primer
(F):5'- AGGCAGTCCCCATTTTAAAGG -3'
(R):5'- TTCACCCGATGTGTGGAGAGTAAC -3'
Posted On2020-07-28