Incidental Mutation 'R8905:Sgsm1'
ID 680021
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8905 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 113273629 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 531 (G531R)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048112
AA Change: G531R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: G531R

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
AA Change: G244R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: G244R

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112324
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112325
AA Change: G531R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: G531R

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154248
AA Change: G586R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: G586R

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Meta Mutation Damage Score 0.1003 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,242 V236A probably benign Het
4931408C20Rik A G 1: 26,682,814 V1095A probably damaging Het
Abca15 A T 7: 120,361,548 R744S probably benign Het
Adgra1 T C 7: 139,875,847 S464P probably damaging Het
Arhgap45 T C 10: 80,019,736 V3A probably benign Het
AW554918 T A 18: 25,340,149 S134T probably damaging Het
Bmper A G 9: 23,406,786 E567G probably benign Het
C2cd3 T C 7: 100,424,925 probably null Het
Cars A G 7: 143,586,459 Y170H probably damaging Het
Ccdc173 A G 2: 69,781,760 S175P probably benign Het
Celsr1 A T 15: 85,904,068 probably benign Het
Celsr3 C T 9: 108,841,302 H2351Y probably damaging Het
Cyp2d11 T C 15: 82,390,901 I282V probably benign Het
Dhfr A G 13: 92,357,959 T57A probably damaging Het
Dnah7b A C 1: 46,253,374 Q2973P probably damaging Het
Dnajc5b T C 3: 19,579,020 C136R probably benign Het
Efcab1 A G 16: 14,920,411 I147V possibly damaging Het
Ercc3 T G 18: 32,265,718 D683E possibly damaging Het
Faxc A G 4: 21,982,398 Y279C probably damaging Het
Fbxw7 T C 3: 84,965,327 M191T possibly damaging Het
Fcgbp T A 7: 28,086,509 V457E probably damaging Het
Fip1l1 A T 5: 74,595,963 T539S probably damaging Het
Gabra1 T C 11: 42,147,225 T189A possibly damaging Het
Glg1 T C 8: 111,158,036 D1118G probably damaging Het
Gli3 A G 13: 15,726,531 D1501G probably benign Het
Gm4756 T A 12: 72,619,657 D80V probably damaging Het
Hacd1 A G 2: 14,044,950 I91T possibly damaging Het
Ift22 T C 5: 136,912,891 V159A probably benign Het
Igkv1-110 T A 6: 68,271,086 Y60N probably damaging Het
Inpp5d A G 1: 87,709,626 K502E probably damaging Het
Kcnt2 A T 1: 140,507,729 Q478L possibly damaging Het
Mettl13 A G 1: 162,537,278 F511L probably damaging Het
Mis18bp1 T C 12: 65,133,627 probably null Het
Mrps30 A T 13: 118,386,943 S98T probably benign Het
Muc2 C T 7: 141,693,400 A209V probably benign Het
Nfs1 A T 2: 156,128,583 I270N probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nsmaf A G 4: 6,424,951 S266P probably benign Het
Obscn A G 11: 59,069,958 S3176P probably damaging Het
Olfr1230 A T 2: 89,296,457 L271Q possibly damaging Het
Olfr834 A G 9: 18,988,198 D70G possibly damaging Het
P2ry12 T A 3: 59,217,576 Y226F probably damaging Het
Pabpc2 C A 18: 39,774,651 T323K probably benign Het
Pank2 A G 2: 131,282,726 D71G possibly damaging Het
Patj A T 4: 98,497,175 H393L probably damaging Het
Pde8b A G 13: 95,046,485 V255A probably damaging Het
Plekhs1 T C 19: 56,482,596 W374R probably damaging Het
Ppm1g T C 5: 31,204,093 D313G probably damaging Het
Rnf114 A G 2: 167,511,214 N135S probably benign Het
Rnf43 T G 11: 87,731,125 Y351D probably damaging Het
Robo1 A T 16: 72,742,285 D90V probably damaging Het
Sbds A G 5: 130,248,284 V172A possibly damaging Het
Scamp5 T A 9: 57,445,386 I167F probably benign Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sfxn1 T A 13: 54,092,414 V159E probably damaging Het
Slc22a26 T A 19: 7,782,966 I471F probably damaging Het
Slc41a3 T A 6: 90,612,141 M78K probably benign Het
Slc8a1 A T 17: 81,441,655 Y653N probably benign Het
Slco6c1 A T 1: 97,125,666 M170K possibly damaging Het
Smarca5 A T 8: 80,713,948 I629K probably benign Het
Smg7 T A 1: 152,840,066 D1099V probably damaging Het
Srbd1 T C 17: 86,001,462 I763V probably benign Het
Stk25 A G 1: 93,629,207 S30P probably damaging Het
Sv2b C T 7: 75,117,711 A646T probably benign Het
Tardbp T C 4: 148,620,636 M167V probably benign Het
Tmem132a T C 19: 10,865,283 N276S probably damaging Het
Ttpa T A 4: 20,028,435 S162T probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Vmn2r3 T A 3: 64,259,274 Y812F probably damaging Het
Yeats2 A G 16: 20,190,394 T463A probably benign Het
Zbtb26 T A 2: 37,436,915 K36N probably benign Het
Zfc3h1 A T 10: 115,423,478 T1652S probably benign Het
Zfp472 G A 17: 32,978,481 C510Y possibly damaging Het
Zfp518a C A 19: 40,914,336 T903K probably damaging Het
Zfp668 T C 7: 127,866,426 T529A probably benign Het
Zfp930 A G 8: 69,228,699 T349A possibly damaging Het
Zmiz2 T G 11: 6,396,840 Y182D probably damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCAGCTGTGGAGTTGG -3'
(R):5'- AGCATCCTCAACTTGGGTTC -3'

Sequencing Primer
(F):5'- TGGCAGGCCATGTTCAGAG -3'
(R):5'- GGTTCCTCCCCTGGAAAAG -3'
Posted On 2021-08-31