Incidental Mutation 'R9173:Gm597'
ID 696511
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9173 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28777349 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 534 (E534V)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: E534V

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: E534V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,403 E1151G probably benign Het
Acaa1a G T 9: 119,341,124 probably benign Het
Clstn1 A G 4: 149,626,107 T79A probably benign Het
Cpd C T 11: 76,808,823 R634Q probably damaging Het
Ctnna2 T C 6: 76,919,956 D753G probably damaging Het
Cyp51 T C 5: 4,086,504 N430S probably benign Het
Dnajc17 A T 2: 119,179,413 V244D probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Dysf A G 6: 84,194,397 K1796E probably benign Het
Eftud2 A T 11: 102,843,416 V659E probably damaging Het
Ercc4 G A 16: 13,122,109 A168T possibly damaging Het
Exd2 T C 12: 80,489,462 Y289H probably benign Het
Fat2 C A 11: 55,278,937 V2999L probably damaging Het
Fgd5 T C 6: 92,067,603 probably null Het
Fkbp9 T C 6: 56,873,404 S422P possibly damaging Het
H2-Eb2 A G 17: 34,333,517 D112G probably benign Het
Herc2 A T 7: 56,206,602 R3929S probably damaging Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Hrc G A 7: 45,337,375 probably null Het
Ighv5-8 T A 12: 113,655,061 V32D probably benign Het
Itgal G T 7: 127,297,617 probably null Het
Jcad T A 18: 4,675,820 V1194E probably benign Het
Kat8 A G 7: 127,912,691 T54A probably benign Het
Kcnu1 G A 8: 25,900,046 probably null Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lama1 A G 17: 67,769,602 T1124A Het
Lrp2 T A 2: 69,469,387 D3107V probably damaging Het
Map6 G A 7: 99,268,728 R236H probably damaging Het
Mycbpap T A 11: 94,506,383 N64I probably damaging Het
Nop14 A G 5: 34,649,432 S443P probably damaging Het
Nxn T C 11: 76,258,734 D380G possibly damaging Het
Olfr388-ps1 T A 11: 73,724,908 I39F possibly damaging Het
Patj A T 4: 98,638,721 M1390L probably benign Het
Pcyox1l A G 18: 61,697,592 L403P probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkhd1l1 A G 15: 44,520,756 S1181G probably benign Het
Ppil2 A T 16: 17,097,434 C103* probably null Het
Prom1 A T 5: 44,063,178 I76N possibly damaging Het
Rnft1 T C 11: 86,486,175 S22P probably benign Het
Sec31a T C 5: 100,381,288 T733A possibly damaging Het
Serpina1c A G 12: 103,896,069 I329T possibly damaging Het
Slco1a4 T C 6: 141,815,573 D438G probably benign Het
Slit2 G A 5: 48,219,943 C438Y probably damaging Het
Sorcs1 T A 19: 50,232,315 I566F possibly damaging Het
Spata7 T A 12: 98,637,594 S73R probably damaging Het
Stau2 G A 1: 16,374,709 R332* probably null Het
Sytl3 T C 17: 6,733,072 F419L probably damaging Het
Tet1 A C 10: 62,840,286 D670E probably benign Het
Trafd1 T C 5: 121,378,535 R202G possibly damaging Het
Tubal3 A T 13: 3,933,050 T277S possibly damaging Het
Ube4b A G 4: 149,331,476 F1054L probably damaging Het
Unc13b C A 4: 43,177,421 Q2750K unknown Het
Usp29 T C 7: 6,961,637 S160P possibly damaging Het
Vmn2r114 A T 17: 23,291,553 I651N probably damaging Het
Zfp11 A T 5: 129,657,827 I190N probably damaging Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCTGAGATGTCCTGAAACCAC -3'
(R):5'- ACAGCATGCAGTTTCCCGAG -3'

Sequencing Primer
(F):5'- ACATGCTCAGACATCTTCCATGG -3'
(R):5'- GCGGAATATTATTCAAAGGCTGCC -3'
Posted On 2022-02-07