Mutagenetix > Incidental Mutation

Incidental Mutation 'R9402:Tns2'

711314

Institutional Source

Beutler Lab

Gene Symbol

Tns2

Ensembl Gene

ENSMUSG00000037003

Gene Name

tensin 2

Synonyms

nph, nep, Tenc1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102100413-102116401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102113188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1096 (H1096R)

Ref Sequence

ENSEMBL: ENSMUSP00000129146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000154032] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000230474]

AlphaFold

Q8CGB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000046144
AA Change: H1103R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: H1103R

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1136	1236	1.69e-16	SMART
PTB	1269	1407	6.66e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154032

SMART Domains

Protein: ENSMUSP00000121493
Gene: ENSMUSG00000036966

Domain	Start	End	E-Value	Type
low complexity region	28	38	N/A	INTRINSIC
SPRY	76	201	1.66e-11	SMART
SPRY	256	441	3.28e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169627
AA Change: H1096R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: H1096R

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1129	1229	1.69e-16	SMART
PTB	1262	1400	6.66e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000228958
AA Change: H1096R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000230474
AA Change: H1088R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	G	1: 136,227,610	S86R	probably benign	Het
Abca9	T	A	11: 110,158,328	Q218L	probably benign	Het
Atg2b	A	G	12: 105,648,423	F1083S	probably damaging	Het
Bche	T	C	3: 73,701,323	N257D	probably benign	Het
Cfap221	T	A	1: 119,932,821	M692L	probably benign	Het
Cfap46	G	T	7: 139,635,949	P1530Q	unknown	Het
Crim1	CCGC	CC	17: 78,350,865		probably null	Het
Cyp4f39	T	C	17: 32,491,209		probably null	Het
Daam1	A	G	12: 71,959,830	T674A	probably benign	Het
Elp2	A	T	18: 24,626,163	I526L	probably benign	Het
Exoc4	T	A	6: 33,476,143	*523K	probably null	Het
Fbxl7	G	A	15: 26,552,503	S226L	probably damaging	Het
Fry	G	A	5: 150,433,696	E1903K	possibly damaging	Het
Fry	G	A	5: 150,436,853	R1988K	probably damaging	Het
Gas1	A	T	13: 60,176,202	M206K	probably damaging	Het
Gbp10	T	A	5: 105,233,997	T96S	possibly damaging	Het
Gm14569	G	A	X: 36,430,896	P1387S	probably damaging	Het
Gpaa1	A	G	15: 76,332,218	T105A	probably benign	Het
Hoxc13	C	A	15: 102,921,616	C143*	probably null	Het
Htt	T	C	5: 34,848,980	I1411T	probably damaging	Het
Jmy	C	T	13: 93,499,170	C46Y	probably damaging	Het
Klhl40	A	G	9: 121,780,416	Y453C	possibly damaging	Het
Krit1	T	A	5: 3,822,210	Y460N	possibly damaging	Het
Lamb3	C	A	1: 193,331,396	T526K		Het
Lrrc29	T	A	8: 105,323,356	Y12F	probably benign	Het
Luzp1	T	A	4: 136,543,182	H905Q	probably damaging	Het
Lyst	T	A	13: 13,637,878	H958Q	probably benign	Het
Magi1	T	C	6: 94,283,297	N9S	probably benign	Het
Mmadhc	A	T	2: 50,281,107	V231E	probably benign	Het
Muc5b	T	A	7: 141,845,414	M364K	unknown	Het
Nae1	A	G	8: 104,528,185		probably null	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nlgn2	A	G	11: 69,828,107	F252S		Het
Nlrp9a	A	T	7: 26,570,605	N874I	possibly damaging	Het
Nodal	T	C	10: 61,423,600	I272T	probably damaging	Het
Olfr1234	C	A	2: 89,362,779	G217*	probably null	Het
Olfr1259	A	T	2: 89,943,940	Y58*	probably null	Het
Olfr599	T	C	7: 103,338,989	S312P	probably benign	Het
Olfr645	G	A	7: 104,084,403	R226*	probably null	Het
Orm1	C	A	4: 63,345,132	Q61K	possibly damaging	Het
Pcdh17	T	C	14: 84,447,206	V371A	probably damaging	Het
Pcdhb19	C	T	18: 37,499,479	Q776*	probably null	Het
Phf14	A	G	6: 11,933,780	R214G	possibly damaging	Het
Phf3	G	A	1: 30,811,847	T1142M	probably damaging	Het
Pigz	A	G	16: 31,945,369	E415G	probably damaging	Het
Pramel5	T	C	4: 144,271,456	T406A	probably benign	Het
Prtg	A	G	9: 72,911,971	E1082G	probably benign	Het
Rtp3	A	G	9: 110,985,963	C445R	unknown	Het
Scn3b	A	T	9: 40,282,556	E193V	probably damaging	Het
Scn7a	A	T	2: 66,680,112	N1315K	probably damaging	Het
Snx14	C	T	9: 88,407,437	G254D	probably damaging	Het
Srbd1	T	C	17: 86,099,277	D560G	probably benign	Het
Srp72	T	A	5: 76,976,482	L65*	probably null	Het
Steap1	T	A	5: 5,740,664	I95F		Het
Taf3	A	G	2: 9,951,112		probably null	Het
Taok2	T	C	7: 126,870,228	N1143D		Het
Tas2r114	C	T	6: 131,689,931	G45S	possibly damaging	Het
Tcerg1l	T	C	7: 138,209,822	K548E	probably damaging	Het
Tcp1	T	A	17: 12,922,618	L328Q	probably benign	Het
Trps1	A	T	15: 50,846,256	Y233N	probably damaging	Het
Tubgcp6	A	G	15: 89,102,861	V1303A	probably benign	Het
Ugt1a2	T	C	1: 88,200,962	F109S	possibly damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Zfp748	A	G	13: 67,545,392	V54A	probably benign	Het

Other mutations in Tns2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01575:Tns2	APN	15	102113191	missense	probably damaging	1.00
IGL01935:Tns2	APN	15	102111634	splice site	probably null
IGL01994:Tns2	APN	15	102111379	missense	possibly damaging	0.81
IGL02025:Tns2	APN	15	102112049	nonsense	probably null
IGL02135:Tns2	APN	15	102113026	missense	probably damaging	1.00
IGL02355:Tns2	APN	15	102112290	missense	probably benign
IGL02362:Tns2	APN	15	102112290	missense	probably benign
IGL02439:Tns2	APN	15	102114543	missense	probably damaging	1.00
IGL02488:Tns2	APN	15	102112743	missense	probably benign
IGL02546:Tns2	APN	15	102110940	missense	probably damaging	1.00
IGL02616:Tns2	APN	15	102111415	missense	probably benign
IGL02628:Tns2	APN	15	102111828	missense	probably benign	0.04
IGL02658:Tns2	APN	15	102107796	splice site	probably benign
IGL03267:Tns2	APN	15	102105378	critical splice donor site	probably null
P0005:Tns2	UTSW	15	102114056	missense	probably damaging	0.98
R0586:Tns2	UTSW	15	102109585	splice site	probably benign
R0791:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0817:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0818:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0819:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0820:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1451:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1454:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1455:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1487:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1510:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1579:Tns2	UTSW	15	102111210	missense	probably damaging	1.00
R1698:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1772:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1779:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1843:Tns2	UTSW	15	102113133	splice site	probably null
R1923:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1924:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1927:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1980:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2051:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2087:Tns2	UTSW	15	102107119	missense	possibly damaging	0.70
R2100:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2103:Tns2	UTSW	15	102112665	critical splice acceptor site	probably null
R2105:Tns2	UTSW	15	102107506	missense	probably benign	0.27
R2224:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2225:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2227:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2252:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2253:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2290:Tns2	UTSW	15	102112023	missense	probably damaging	0.99
R2304:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2318:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2446:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2447:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2448:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2566:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2567:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2897:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2898:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3159:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3160:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3196:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3237:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3426:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3427:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3428:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3695:Tns2	UTSW	15	102112749	missense	probably null
R3767:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3911:Tns2	UTSW	15	102113837	critical splice donor site	probably null
R4113:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4157:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4394:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4395:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4396:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4439:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4441:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4537:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4538:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4541:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4599:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4600:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4602:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4773:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4774:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4775:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4776:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4880:Tns2	UTSW	15	102112039	missense	probably damaging	0.98
R4989:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5014:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5058:Tns2	UTSW	15	102107860	missense	possibly damaging	0.68
R5253:Tns2	UTSW	15	102111453	missense	probably damaging	1.00
R5336:Tns2	UTSW	15	102111229	missense	probably damaging	1.00
R5351:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5629:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5630:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5631:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5685:Tns2	UTSW	15	102107103	missense	probably benign	0.02
R5844:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6048:Tns2	UTSW	15	102111411	missense	probably damaging	1.00
R6067:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6079:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6130:Tns2	UTSW	15	102111241	missense	probably damaging	1.00
R6136:Tns2	UTSW	15	102107030	missense	probably damaging	1.00
R6138:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6199:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6210:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6426:Tns2	UTSW	15	102107037	missense	possibly damaging	0.65
R6544:Tns2	UTSW	15	102113834	missense	possibly damaging	0.93
R6594:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6596:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6734:Tns2	UTSW	15	102103116	missense	probably damaging	0.96
R7061:Tns2	UTSW	15	102104479	start codon destroyed	probably null
R7070:Tns2	UTSW	15	102104533	missense	possibly damaging	0.58
R7110:Tns2	UTSW	15	102105366	missense	probably damaging	0.99
R7410:Tns2	UTSW	15	102110526	missense	probably damaging	1.00
R7447:Tns2	UTSW	15	102110916	missense	probably damaging	1.00
R7751:Tns2	UTSW	15	102109728	missense	probably benign	0.02
R8052:Tns2	UTSW	15	102112845	missense	probably damaging	1.00
R8114:Tns2	UTSW	15	102111390	missense	probably benign	0.01
R8906:Tns2	UTSW	15	102111604	missense	probably damaging	1.00
R8964:Tns2	UTSW	15	102103118	missense	possibly damaging	0.73
R9192:Tns2	UTSW	15	102112981	missense	probably damaging	1.00
R9273:Tns2	UTSW	15	102113043	missense	probably damaging	1.00
R9307:Tns2	UTSW	15	102110561	missense	probably damaging	0.97
R9612:Tns2	UTSW	15	102107142	missense	probably damaging	1.00
R9655:Tns2	UTSW	15	102104498	missense	probably benign	0.03
U15987:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
X0009:Tns2	UTSW	15	102112465	missense	possibly damaging	0.94
X0026:Tns2	UTSW	15	102110502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCACTTCAGATAGCCCAGATG -3'
(R):5'- CAAACTTGACATTGCTTTGGTTCTC -3'

Sequencing Primer
(F):5'- TGTGCCTACCCAGATGCC -3'
(R):5'- CTCTTGTAAAGGGTGTTCTAGAAGAG -3'

Posted On

2022-05-16