Incidental Mutation 'R9402:Cfap46'
ID 711291
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 139635949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 1530 (P1530Q)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
AlphaFold E9Q2C0
Predicted Effect unknown
Transcript: ENSMUST00000129990
AA Change: P1530Q
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: P1530Q

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T G 1: 136,227,610 S86R probably benign Het
Abca9 T A 11: 110,158,328 Q218L probably benign Het
Atg2b A G 12: 105,648,423 F1083S probably damaging Het
Bche T C 3: 73,701,323 N257D probably benign Het
Cfap221 T A 1: 119,932,821 M692L probably benign Het
Crim1 CCGC CC 17: 78,350,865 probably null Het
Cyp4f39 T C 17: 32,491,209 probably null Het
Daam1 A G 12: 71,959,830 T674A probably benign Het
Elp2 A T 18: 24,626,163 I526L probably benign Het
Exoc4 T A 6: 33,476,143 *523K probably null Het
Fbxl7 G A 15: 26,552,503 S226L probably damaging Het
Fry G A 5: 150,436,853 R1988K probably damaging Het
Fry G A 5: 150,433,696 E1903K possibly damaging Het
Gas1 A T 13: 60,176,202 M206K probably damaging Het
Gbp10 T A 5: 105,233,997 T96S possibly damaging Het
Gm14569 G A X: 36,430,896 P1387S probably damaging Het
Gpaa1 A G 15: 76,332,218 T105A probably benign Het
Hoxc13 C A 15: 102,921,616 C143* probably null Het
Htt T C 5: 34,848,980 I1411T probably damaging Het
Jmy C T 13: 93,499,170 C46Y probably damaging Het
Klhl40 A G 9: 121,780,416 Y453C possibly damaging Het
Krit1 T A 5: 3,822,210 Y460N possibly damaging Het
Lamb3 C A 1: 193,331,396 T526K Het
Lrrc29 T A 8: 105,323,356 Y12F probably benign Het
Luzp1 T A 4: 136,543,182 H905Q probably damaging Het
Lyst T A 13: 13,637,878 H958Q probably benign Het
Magi1 T C 6: 94,283,297 N9S probably benign Het
Mmadhc A T 2: 50,281,107 V231E probably benign Het
Muc5b T A 7: 141,845,414 M364K unknown Het
Nae1 A G 8: 104,528,185 probably null Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nlgn2 A G 11: 69,828,107 F252S Het
Nlrp9a A T 7: 26,570,605 N874I possibly damaging Het
Nodal T C 10: 61,423,600 I272T probably damaging Het
Olfr1234 C A 2: 89,362,779 G217* probably null Het
Olfr1259 A T 2: 89,943,940 Y58* probably null Het
Olfr599 T C 7: 103,338,989 S312P probably benign Het
Olfr645 G A 7: 104,084,403 R226* probably null Het
Orm1 C A 4: 63,345,132 Q61K possibly damaging Het
Pcdh17 T C 14: 84,447,206 V371A probably damaging Het
Pcdhb19 C T 18: 37,499,479 Q776* probably null Het
Phf14 A G 6: 11,933,780 R214G possibly damaging Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Pigz A G 16: 31,945,369 E415G probably damaging Het
Pramel5 T C 4: 144,271,456 T406A probably benign Het
Prtg A G 9: 72,911,971 E1082G probably benign Het
Rtp3 A G 9: 110,985,963 C445R unknown Het
Scn3b A T 9: 40,282,556 E193V probably damaging Het
Scn7a A T 2: 66,680,112 N1315K probably damaging Het
Snx14 C T 9: 88,407,437 G254D probably damaging Het
Srbd1 T C 17: 86,099,277 D560G probably benign Het
Srp72 T A 5: 76,976,482 L65* probably null Het
Steap1 T A 5: 5,740,664 I95F Het
Taf3 A G 2: 9,951,112 probably null Het
Taok2 T C 7: 126,870,228 N1143D Het
Tas2r114 C T 6: 131,689,931 G45S possibly damaging Het
Tcerg1l T C 7: 138,209,822 K548E probably damaging Het
Tcp1 T A 17: 12,922,618 L328Q probably benign Het
Tns2 A G 15: 102,113,188 H1096R probably damaging Het
Trps1 A T 15: 50,846,256 Y233N probably damaging Het
Tubgcp6 A G 15: 89,102,861 V1303A probably benign Het
Ugt1a2 T C 1: 88,200,962 F109S possibly damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Zfp748 A G 13: 67,545,392 V54A probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9443:Cfap46 UTSW 7 139615107 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTACTACCTACACAATCAGGGACAG -3'
(R):5'- AAAGACCTGCTGAGTGCTGAG -3'

Sequencing Primer
(F):5'- GACAGAATTAATATCTGAGGTGCTGC -3'
(R):5'- GAACTTGAGGCAGCTCTTCACAG -3'
Posted On 2022-05-16