Mutagenetix > Incidental Mutation

Incidental Mutation 'R9419:Dusp27'

712204

Institutional Source

Beutler Lab

Gene Symbol

Dusp27

Ensembl Gene

ENSMUSG00000026564

Gene Name

dual specificity phosphatase 27 (putative)

Synonyms

C130085G02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9419 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

166098148-166127922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 166100186 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 619 (Q619R)

Ref Sequence

ENSEMBL: ENSMUSP00000083155 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]

AlphaFold

Q148W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000085992
AA Change: Q619R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: Q619R

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192369
AA Change: Q619R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: Q619R

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700064H15Rik	T	C	3: 19,628,521	T30A	unknown	Het
A430089I19Rik	G	T	5: 94,303,142	P375H	probably damaging	Het
Abca12	A	G	1: 71,303,490	Y944H	possibly damaging	Het
Adgrv1	T	C	13: 81,508,768	N2869S	probably benign	Het
Ank1	C	A	8: 23,084,809	Q140K	probably damaging	Het
Aspm	T	A	1: 139,457,185	M189K	probably benign	Het
Atp2b1	G	T	10: 99,001,316	R539L	possibly damaging	Het
Camsap1	A	G	2: 25,955,292	S152P		Het
Catsperd	A	T	17: 56,651,821	I276L	probably benign	Het
Cbarp	A	G	10: 80,132,027	V460A	probably damaging	Het
Cd40	A	T	2: 165,062,242		probably benign	Het
Cdk11b	A	T	4: 155,639,845	T307S	unknown	Het
Chfr	C	T	5: 110,169,190	T643I	probably damaging	Het
Cnbd1	T	C	4: 19,098,156	Q88R	probably benign	Het
Col15a1	G	C	4: 47,288,200		probably benign	Het
Ghdc	G	T	11: 100,770,255	A28D	probably damaging	Het
Gm5114	T	C	7: 39,408,116	H693R	possibly damaging	Het
Gm8251	T	C	1: 44,057,775	I1388V	probably benign	Het
H2-M1	G	T	17: 36,670,339	A268E	probably damaging	Het
Hsf5	A	G	11: 87,638,109	N557D	probably benign	Het
Ighg2c	A	G	12: 113,287,395		probably benign	Het
Il17ra	C	A	6: 120,481,294	Q469K	possibly damaging	Het
Ipo8	T	A	6: 148,784,566	N809Y	probably benign	Het
Klra10	T	A	6: 130,279,472	Q73L	probably damaging	Het
Lamb2	T	C	9: 108,479,760	V3A	unknown	Het
Map3k9	T	C	12: 81,780,567	Y103C	probably damaging	Het
Map4	T	C	9: 110,052,961	S298P	possibly damaging	Het
Mtus2	T	A	5: 148,306,641	N1254K	probably damaging	Het
Nap1l5	T	A	6: 58,906,967	M1L	probably benign	Het
Nfxl1	G	A	5: 72,559,298		probably benign	Het
Nmd3	T	C	3: 69,736,016	I227T	probably benign	Het
Olfr250	T	G	9: 38,367,866	C97G	probably damaging	Het
Ptchd3	G	A	11: 121,841,530	M415I	possibly damaging	Het
Rab28	A	T	5: 41,635,839	S154R	possibly damaging	Het
Rin1	A	G	19: 5,053,707	E567G	probably damaging	Het
Rrbp1	A	C	2: 143,969,516	V806G	probably benign	Het
Sec63	T	A	10: 42,803,905	L326Q	probably damaging	Het
Serinc2	T	C	4: 130,255,522	T296A	probably damaging	Het
Skint10	G	A	4: 112,715,784	L272F	probably damaging	Het
Slc4a11	C	T	2: 130,691,744	A100T	probably damaging	Het
Stag1	A	G	9: 100,929,914	Q815R	probably benign	Het
Stat3	A	G	11: 100,889,531	M735T	possibly damaging	Het
Stat3	A	G	11: 100,893,912	I576T	probably benign	Het
Syne1	T	C	10: 5,205,071	K5623E	probably benign	Het
Tas1r2	T	C	4: 139,659,725	V165A	possibly damaging	Het
Tcaf3	A	T	6: 42,596,782	D165E	probably benign	Het
Tex2	G	A	11: 106,567,009	Q532*	probably null	Het
Utrn	T	C	10: 12,688,381	E1245G	probably damaging	Het

Other mutations in Dusp27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Dusp27	APN	1	166100552	missense	probably benign	0.00
IGL00973:Dusp27	APN	1	166099458	missense	probably benign
IGL01331:Dusp27	APN	1	166108180	missense	probably damaging	1.00
IGL01466:Dusp27	APN	1	166100504	missense	probably damaging	1.00
IGL01572:Dusp27	APN	1	166100372	missense	probably benign	0.18
IGL01906:Dusp27	APN	1	166099523	missense	probably damaging	1.00
IGL01974:Dusp27	APN	1	166100536	nonsense	probably null
IGL02112:Dusp27	APN	1	166099671	nonsense	probably null
IGL02805:Dusp27	APN	1	166099061	missense	probably damaging	1.00
IGL03343:Dusp27	APN	1	166099448	missense	probably benign	0.00
R0116:Dusp27	UTSW	1	166099701	missense	probably benign	0.19
R0367:Dusp27	UTSW	1	166100763	missense	probably benign	0.05
R0499:Dusp27	UTSW	1	166099101	missense	probably benign	0.00
R0542:Dusp27	UTSW	1	166101284	missense	possibly damaging	0.90
R1312:Dusp27	UTSW	1	166099291	missense	possibly damaging	0.46
R1572:Dusp27	UTSW	1	166099455	missense	possibly damaging	0.68
R1598:Dusp27	UTSW	1	166110259	missense	probably benign	0.10
R1858:Dusp27	UTSW	1	166100846	missense	possibly damaging	0.87
R2021:Dusp27	UTSW	1	166100823	missense	probably benign	0.00
R2970:Dusp27	UTSW	1	166099229	missense	probably benign	0.04
R3727:Dusp27	UTSW	1	166099506	missense	probably damaging	1.00
R4041:Dusp27	UTSW	1	166100111	missense	probably benign	0.01
R4245:Dusp27	UTSW	1	166101116	missense	probably damaging	1.00
R4955:Dusp27	UTSW	1	166108092	missense	probably damaging	1.00
R4967:Dusp27	UTSW	1	166127106	missense	probably damaging	1.00
R5040:Dusp27	UTSW	1	166100345	missense	probably benign	0.17
R5342:Dusp27	UTSW	1	166110250	missense	probably benign	0.01
R5467:Dusp27	UTSW	1	166112030	critical splice donor site	probably null
R5742:Dusp27	UTSW	1	166099454	missense	probably benign	0.00
R6222:Dusp27	UTSW	1	166098645	missense	probably benign	0.26
R6239:Dusp27	UTSW	1	166098819	missense	probably damaging	1.00
R6531:Dusp27	UTSW	1	166110046	splice site	probably null
R6586:Dusp27	UTSW	1	166100885	missense	possibly damaging	0.79
R6958:Dusp27	UTSW	1	166107996	missense	probably damaging	1.00
R7006:Dusp27	UTSW	1	166099094	missense	probably benign
R7111:Dusp27	UTSW	1	166127154	missense	possibly damaging	0.66
R7310:Dusp27	UTSW	1	166098731	missense	possibly damaging	0.46
R7312:Dusp27	UTSW	1	166127107	missense	probably damaging	0.99
R7378:Dusp27	UTSW	1	166112063	nonsense	probably null
R7398:Dusp27	UTSW	1	166100475	missense	probably damaging	1.00
R7442:Dusp27	UTSW	1	166101015	missense	probably benign	0.01
R7569:Dusp27	UTSW	1	166108035	missense	probably damaging	1.00
R7920:Dusp27	UTSW	1	166099896	missense	possibly damaging	0.72
R7954:Dusp27	UTSW	1	166099280	missense	probably benign	0.05
R7972:Dusp27	UTSW	1	166099139	missense	probably damaging	1.00
R8186:Dusp27	UTSW	1	166100079	missense	probably damaging	1.00
R8354:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8454:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8535:Dusp27	UTSW	1	166101161	missense	probably benign	0.01
R9493:Dusp27	UTSW	1	166098841	missense	probably damaging	1.00
R9694:Dusp27	UTSW	1	166101085	missense	probably damaging	1.00
Z1088:Dusp27	UTSW	1	166099283	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGCATGAGAACGGTGGC -3'
(R):5'- TTCACAAGAAAGACTCGGAGGC -3'

Sequencing Primer
(F):5'- CATGAGAACGGTGGCTCTGG -3'
(R):5'- ACTCGGAGGCGGGAGAC -3'

Posted On

2022-05-16