Incidental Mutation 'R9616:Vmn2r6'
ID 724566
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG620718, EG667069
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock # R9616 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64537561-64565298 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64538303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 667 (L667P)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect probably damaging
Transcript: ENSMUST00000165012
AA Change: L578P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: L578P

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176481
AA Change: L667P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: L667P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040M04Rik T A 1: 151,204,729 D189E probably benign Het
Abca13 A T 11: 9,290,501 H788L probably benign Het
Abcb1b A G 5: 8,812,779 I154V probably benign Het
Acsm4 A G 7: 119,694,649 N81S probably benign Het
Adamts5 G A 16: 85,862,786 H873Y probably benign Het
Aox4 C T 1: 58,228,861 T200I possibly damaging Het
Arhgap33 A G 7: 30,529,942 V336A probably damaging Het
Brca1 C T 11: 101,525,857 E484K probably damaging Het
Capn13 T A 17: 73,365,969 D113V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam3 G A 7: 17,158,153 E274K Het
Cfh A T 1: 140,102,516 I891K probably damaging Het
Cgn A G 3: 94,763,025 S1041P probably damaging Het
Cldn18 T C 9: 99,698,862 D111G probably benign Het
Cnp G A 11: 100,576,435 R68Q probably benign Het
Cntn4 T A 6: 106,697,564 C1008* probably null Het
Cntnap5a T C 1: 116,101,593 I259T probably benign Het
Cubn A G 2: 13,314,718 I2897T probably benign Het
Cyp2c39 T A 19: 39,513,204 L67Q probably damaging Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddc C T 11: 11,822,288 W349* probably null Het
Dennd3 A G 15: 73,568,714 E1198G probably benign Het
Dnah1 T C 14: 31,304,443 D826G probably null Het
Dpp4 T C 2: 62,387,085 Y56C probably damaging Het
Etv6 A G 6: 134,266,332 D350G possibly damaging Het
Fam129a T C 1: 151,636,442 Y32H probably damaging Het
Fat1 C A 8: 44,953,038 P942Q probably damaging Het
Fbxl5 A G 5: 43,758,817 F418L probably benign Het
Fbxo11 T A 17: 88,008,670 H368L Het
Fhl2 G T 1: 43,128,386 H182Q probably damaging Het
Gabpa T A 16: 84,852,573 C223S probably damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Greb1 A T 12: 16,740,037 N3K probably damaging Het
Hmcn1 T G 1: 150,808,722 S366R probably benign Het
Il17b A G 18: 61,692,292 Q133R probably benign Het
Inha T A 1: 75,509,567 S169T probably benign Het
Itsn1 G A 16: 91,853,167 R243H probably benign Het
Kcnu1 G GA 8: 25,913,647 probably null Het
Kdm1b A G 13: 47,080,554 E788G probably damaging Het
Kdm2a A T 19: 4,320,280 I1059N probably damaging Het
Klk1b9 G T 7: 43,979,371 G100C probably benign Het
Knl1 T C 2: 119,069,513 V565A probably benign Het
Knl1 A T 2: 119,076,944 N1650Y probably damaging Het
Lpp T C 16: 24,761,969 V270A probably benign Het
Lrrc15 A G 16: 30,273,699 L274P probably damaging Het
Mertk C T 2: 128,801,335 L885F probably benign Het
Mpst T A 15: 78,410,161 L31* probably null Het
Ms4a10 T C 19: 10,967,076 T115A possibly damaging Het
Myof A G 19: 37,934,815 I1330T possibly damaging Het
Ncam2 T C 16: 81,443,254 I201T probably damaging Het
Nefh T A 11: 4,939,443 K1059* probably null Het
Nek1 T C 8: 61,020,073 Y168H probably damaging Het
Nek11 T A 9: 105,204,812 T531S probably damaging Het
Nelfa G A 5: 33,901,783 P243S possibly damaging Het
Notum G T 11: 120,660,148 T64K Het
Olfr1504 A G 19: 13,887,497 S238P probably damaging Het
Olfr159 T A 4: 43,770,193 K273* probably null Het
Olfr691 A C 7: 105,337,313 Y134* probably null Het
Otof A G 5: 30,382,364 I1035T possibly damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Per1 G T 11: 69,102,728 C368F probably damaging Het
Pitrm1 G T 13: 6,555,566 R183L probably damaging Het
Prl3a1 C T 13: 27,275,135 A119V Het
Pycard C T 7: 127,993,604 G17E probably benign Het
Rnf13 A G 3: 57,833,009 D249G possibly damaging Het
Sdhaf2 T C 19: 10,517,325 Y33C probably damaging Het
Sdk2 A G 11: 113,800,235 V1838A probably benign Het
Sgo2b C T 8: 63,927,240 V853I probably benign Het
Slc1a4 T C 11: 20,332,403 T24A probably benign Het
Slc8a1 T C 17: 81,647,978 T544A probably benign Het
Sntg2 T C 12: 30,276,733 N143S probably benign Het
Sphkap T C 1: 83,277,268 E920G probably damaging Het
Srgap2 T A 1: 131,325,090 H132L Het
Srgap3 A T 6: 112,771,563 V376D probably damaging Het
Stxbp5l T C 16: 37,215,952 K434E probably damaging Het
Tab2 A T 10: 7,919,241 N492K possibly damaging Het
Tbc1d32 T C 10: 56,161,150 Q666R possibly damaging Het
Tekt4 T C 17: 25,473,808 probably null Het
Tnni3k G A 3: 154,962,087 Q230* probably null Het
Trp53bp1 A C 2: 121,236,176 S690A probably benign Het
Trpa1 C A 1: 14,918,853 probably benign Het
Trpm1 T G 7: 64,208,384 V324G probably damaging Het
Usp29 A G 7: 6,963,180 E674G possibly damaging Het
Vmn2r59 T C 7: 42,011,875 R839G probably damaging Het
Vmn2r91 T A 17: 18,136,043 F657L possibly damaging Het
Vps13d A G 4: 145,098,131 V2923A Het
Xylb T A 9: 119,371,956 L220Q probably damaging Het
Zbtb10 C T 3: 9,251,413 T95M probably benign Het
Zfp263 C T 16: 3,749,618 P599L probably damaging Het
Zfp532 A G 18: 65,656,568 E1026G probably benign Het
Zfp78 A G 7: 6,379,079 N376S probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64559820 missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64556105 nonsense probably null
R8736:Vmn2r6 UTSW 3 64559800 missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64556155 missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64556856 missense probably benign 0.12
R9206:Vmn2r6 UTSW 3 64559611 missense probably damaging 0.97
R9295:Vmn2r6 UTSW 3 64556063 missense probably benign 0.00
R9332:Vmn2r6 UTSW 3 64547250 missense probably benign 0.01
R9663:Vmn2r6 UTSW 3 64556128 missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64556660 missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGGGGTGCATGGATATTAGC -3'
(R):5'- AAATGACTGGTCCAATGCGG -3'

Sequencing Primer
(F):5'- GCCGAGTTTTAGATATGGAAATCCTG -3'
(R):5'- AACAAGTGTGTGCCAAAGC -3'
Posted On 2022-09-12