Incidental Mutation 'R9688:Naa16'
ID 729008
Institutional Source Beutler Lab
Gene Symbol Naa16
Ensembl Gene ENSMUSG00000022020
Gene Name N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms Narg1l, 1300019C06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9688 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 79325269-79390778 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 79335869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 820 (Y820*)
Ref Sequence ENSEMBL: ENSMUSP00000022597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022597]
AlphaFold Q9DBB4
Predicted Effect probably null
Transcript: ENSMUST00000022597
AA Change: Y820*
SMART Domains Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: Y820*

DomainStartEndE-ValueType
TPR 46 79 2.99e1 SMART
TPR 80 113 2.98e-3 SMART
Blast:TPR 224 257 1e-10 BLAST
TPR 374 407 9.96e0 SMART
TPR 408 441 7.47e0 SMART
low complexity region 616 633 N/A INTRINSIC
Blast:TPR 672 705 3e-12 BLAST
low complexity region 830 841 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,519,067 probably null Het
Abca2 G C 2: 25,434,447 A272P possibly damaging Het
Adarb1 T A 10: 77,311,265 D479V probably damaging Het
Amz2 T C 11: 109,429,939 F162S probably damaging Het
Ano4 A T 10: 89,344,644 M1K probably null Het
Antxr1 G A 6: 87,137,352 R478C probably damaging Het
Apobr T C 7: 126,587,491 S725P probably benign Het
Arap2 A T 5: 62,714,766 D506E probably damaging Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Camk1g T A 1: 193,348,721 R305W probably damaging Het
Ces2g A T 8: 104,964,672 I147F probably benign Het
Cfap61 T C 2: 146,036,838 F505L probably damaging Het
Cndp1 G C 18: 84,637,857 N62K probably benign Het
Cog6 G T 3: 53,009,107 Q214K probably benign Het
Depdc5 T A 5: 32,897,932 Y226* probably null Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Ercc6 A C 14: 32,575,798 H1334P probably benign Het
Ern1 T C 11: 106,459,010 T27A possibly damaging Het
Esf1 A T 2: 140,168,175 D80E probably damaging Het
Evpl T C 11: 116,234,160 K159E probably damaging Het
Gbx1 T C 5: 24,526,512 Y102C probably damaging Het
Gjd2 A G 2: 114,011,628 S123P probably benign Het
H2-M11 A G 17: 36,548,162 Y198C probably damaging Het
Hps1 A C 19: 42,766,708 V265G probably benign Het
Ifna16 C A 4: 88,676,637 E74* probably null Het
Inca1 C T 11: 70,688,984 probably null Het
Jag2 A G 12: 112,908,944 V1230A probably benign Het
Jam3 G A 9: 27,098,908 T260M probably benign Het
Klhl5 A T 5: 65,164,587 D652V probably damaging Het
L3mbtl1 A T 2: 162,948,777 I81L possibly damaging Het
Lgalsl C T 11: 20,829,442 A68T probably benign Het
Map3k14 T A 11: 103,239,233 D286V possibly damaging Het
Mdn1 A G 4: 32,745,590 I4083V probably damaging Het
Ms4a5 T C 19: 11,276,694 I136M possibly damaging Het
Nbea G T 3: 55,649,744 N2537K probably benign Het
Ncapd3 A G 9: 27,056,053 S562G probably benign Het
Olfr1093 A C 2: 86,786,661 K310N probably damaging Het
Olfr786 C A 10: 129,437,098 C95* probably null Het
Papd7 A G 13: 69,507,080 L425P probably damaging Het
Pcdhac2 A G 18: 37,144,575 S203G probably benign Het
Pds5a A T 5: 65,654,853 F309I probably benign Het
Pdzd8 G A 19: 59,345,251 L113F probably benign Het
Pex12 T C 11: 83,298,431 Y4C possibly damaging Het
Ppfibp2 A G 7: 107,719,241 D332G probably benign Het
Psg23 A T 7: 18,610,622 W303R probably damaging Het
Pyy T A 11: 102,107,273 D27V probably damaging Het
Rc3h1 A G 1: 160,942,664 Q302R probably damaging Het
Rhoh A G 5: 65,892,313 probably benign Het
Samd9l A G 6: 3,377,087 M58T probably damaging Het
Scaf11 A C 15: 96,415,927 H1324Q probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Setx A T 2: 29,146,316 S938C probably damaging Het
Sgo2a A T 1: 58,017,578 T974S probably damaging Het
Sh3rf1 T C 8: 61,226,314 V130A probably benign Het
Slc43a2 T C 11: 75,543,286 F97L probably damaging Het
Slc9a9 C A 9: 95,229,054 Q642K probably benign Het
Soga3 T C 10: 29,196,695 V661A possibly damaging Het
Sox6 G T 7: 115,476,990 D804E probably benign Het
Tbx15 A T 3: 99,326,392 R290S possibly damaging Het
Terf2 A G 8: 107,094,911 S176P probably damaging Het
Ttc6 A T 12: 57,673,816 H956L possibly damaging Het
Tti2 T C 8: 31,154,251 V292A probably damaging Het
Vmn1r29 A T 6: 58,307,754 E153V probably benign Het
Vmn1r55 G T 7: 5,146,670 H251Q probably benign Het
Yeats4 T C 10: 117,215,681 T224A probably benign Het
Yipf4 T A 17: 74,499,083 F239Y probably benign Het
Zan T C 5: 137,468,455 D380G probably damaging Het
Zbtb9 T C 17: 26,974,920 F433S probably damaging Het
Zic5 T C 14: 122,464,023 K432R unknown Het
Other mutations in Naa16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Naa16 APN 14 79355729 missense probably damaging 1.00
IGL01025:Naa16 APN 14 79384756 missense probably damaging 1.00
IGL01155:Naa16 APN 14 79384715 missense probably damaging 0.98
IGL01335:Naa16 APN 14 79345116 splice site probably benign
IGL01981:Naa16 APN 14 79381516 missense probably benign 0.05
IGL02230:Naa16 APN 14 79377361 splice site probably benign
IGL02313:Naa16 APN 14 79384668 missense probably damaging 1.00
IGL02418:Naa16 APN 14 79383366 missense probably damaging 1.00
IGL02544:Naa16 APN 14 79335820 missense probably damaging 1.00
IGL03051:Naa16 APN 14 79369082 missense probably benign 0.01
IGL03064:Naa16 APN 14 79339628 missense probably damaging 0.98
IGL03205:Naa16 APN 14 79356512 missense possibly damaging 0.89
PIT4508001:Naa16 UTSW 14 79369087 missense probably benign 0.15
R0651:Naa16 UTSW 14 79351392 missense probably damaging 1.00
R1429:Naa16 UTSW 14 79359527 missense probably benign 0.01
R1674:Naa16 UTSW 14 79387057 start codon destroyed probably null 0.65
R1693:Naa16 UTSW 14 79351456 missense probably damaging 1.00
R1874:Naa16 UTSW 14 79355743 missense possibly damaging 0.62
R1992:Naa16 UTSW 14 79356491 missense probably damaging 1.00
R2015:Naa16 UTSW 14 79345059 missense probably damaging 1.00
R2391:Naa16 UTSW 14 79370049 missense probably benign 0.16
R2847:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2848:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2877:Naa16 UTSW 14 79343298 missense probably benign 0.00
R3884:Naa16 UTSW 14 79343262 missense probably damaging 0.98
R4001:Naa16 UTSW 14 79343121 splice site probably null
R4199:Naa16 UTSW 14 79355871 missense probably damaging 1.00
R4638:Naa16 UTSW 14 79340033 splice site probably null
R4676:Naa16 UTSW 14 79336348 unclassified probably benign
R4690:Naa16 UTSW 14 79345057 missense probably damaging 1.00
R4952:Naa16 UTSW 14 79345085 missense probably damaging 1.00
R5087:Naa16 UTSW 14 79377415 missense possibly damaging 0.68
R5104:Naa16 UTSW 14 79384700 nonsense probably null
R5729:Naa16 UTSW 14 79355780 missense probably damaging 1.00
R6178:Naa16 UTSW 14 79383340 missense possibly damaging 0.93
R6960:Naa16 UTSW 14 79359471 missense possibly damaging 0.65
R7794:Naa16 UTSW 14 79377494 missense probably damaging 1.00
R7936:Naa16 UTSW 14 79341046 missense possibly damaging 0.47
R8356:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8456:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8892:Naa16 UTSW 14 79390576 missense probably benign 0.32
R8931:Naa16 UTSW 14 79344955 missense probably damaging 1.00
R9010:Naa16 UTSW 14 79370042 missense probably benign 0.01
R9068:Naa16 UTSW 14 79374849 missense probably benign 0.18
R9360:Naa16 UTSW 14 79356503 missense probably benign 0.05
X0064:Naa16 UTSW 14 79351389 missense probably damaging 1.00
Z1177:Naa16 UTSW 14 79344979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTTGAGTCTTAGGAGCAAC -3'
(R):5'- AAATTGGAATCCTGCGTCACCC -3'

Sequencing Primer
(F):5'- GAGTCTTAGGAGCAACTTCCC -3'
(R):5'- TGGGCCTCCATAACCAGCTC -3'
Posted On 2022-10-06