Mutagenetix > Incidental Mutation

Incidental Mutation 'R9688:Tbx15'

728962

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R9688 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99326392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 290 (R290S)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: R290S

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: R290S

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	G	11: 23,519,067		probably null	Het
Abca2	G	C	2: 25,434,447	A272P	possibly damaging	Het
Adarb1	T	A	10: 77,311,265	D479V	probably damaging	Het
Amz2	T	C	11: 109,429,939	F162S	probably damaging	Het
Ano4	A	T	10: 89,344,644	M1K	probably null	Het
Antxr1	G	A	6: 87,137,352	R478C	probably damaging	Het
Apobr	T	C	7: 126,587,491	S725P	probably benign	Het
Arap2	A	T	5: 62,714,766	D506E	probably damaging	Het
Ash1l	T	G	3: 88,984,717	I1301S	probably damaging	Het
Camk1g	T	A	1: 193,348,721	R305W	probably damaging	Het
Ces2g	A	T	8: 104,964,672	I147F	probably benign	Het
Cfap61	T	C	2: 146,036,838	F505L	probably damaging	Het
Cndp1	G	C	18: 84,637,857	N62K	probably benign	Het
Cog6	G	T	3: 53,009,107	Q214K	probably benign	Het
Depdc5	T	A	5: 32,897,932	Y226*	probably null	Het
Elp5	T	A	11: 69,970,599	I185F	probably damaging	Het
Ercc6	A	C	14: 32,575,798	H1334P	probably benign	Het
Ern1	T	C	11: 106,459,010	T27A	possibly damaging	Het
Esf1	A	T	2: 140,168,175	D80E	probably damaging	Het
Evpl	T	C	11: 116,234,160	K159E	probably damaging	Het
Gbx1	T	C	5: 24,526,512	Y102C	probably damaging	Het
Gjd2	A	G	2: 114,011,628	S123P	probably benign	Het
H2-M11	A	G	17: 36,548,162	Y198C	probably damaging	Het
Hps1	A	C	19: 42,766,708	V265G	probably benign	Het
Ifna16	C	A	4: 88,676,637	E74*	probably null	Het
Inca1	C	T	11: 70,688,984		probably null	Het
Jag2	A	G	12: 112,908,944	V1230A	probably benign	Het
Jam3	G	A	9: 27,098,908	T260M	probably benign	Het
Klhl5	A	T	5: 65,164,587	D652V	probably damaging	Het
L3mbtl1	A	T	2: 162,948,777	I81L	possibly damaging	Het
Lgalsl	C	T	11: 20,829,442	A68T	probably benign	Het
Map3k14	T	A	11: 103,239,233	D286V	possibly damaging	Het
Mdn1	A	G	4: 32,745,590	I4083V	probably damaging	Het
Ms4a5	T	C	19: 11,276,694	I136M	possibly damaging	Het
Naa16	A	T	14: 79,335,869	Y820*	probably null	Het
Nbea	G	T	3: 55,649,744	N2537K	probably benign	Het
Ncapd3	A	G	9: 27,056,053	S562G	probably benign	Het
Olfr1093	A	C	2: 86,786,661	K310N	probably damaging	Het
Olfr786	C	A	10: 129,437,098	C95*	probably null	Het
Papd7	A	G	13: 69,507,080	L425P	probably damaging	Het
Pcdhac2	A	G	18: 37,144,575	S203G	probably benign	Het
Pds5a	A	T	5: 65,654,853	F309I	probably benign	Het
Pdzd8	G	A	19: 59,345,251	L113F	probably benign	Het
Pex12	T	C	11: 83,298,431	Y4C	possibly damaging	Het
Ppfibp2	A	G	7: 107,719,241	D332G	probably benign	Het
Psg23	A	T	7: 18,610,622	W303R	probably damaging	Het
Pyy	T	A	11: 102,107,273	D27V	probably damaging	Het
Rc3h1	A	G	1: 160,942,664	Q302R	probably damaging	Het
Rhoh	A	G	5: 65,892,313		probably benign	Het
Samd9l	A	G	6: 3,377,087	M58T	probably damaging	Het
Scaf11	A	C	15: 96,415,927	H1324Q	probably damaging	Het
Serinc2	C	A	4: 130,264,340	A105S	probably damaging	Het
Setx	A	T	2: 29,146,316	S938C	probably damaging	Het
Sgo2a	A	T	1: 58,017,578	T974S	probably damaging	Het
Sh3rf1	T	C	8: 61,226,314	V130A	probably benign	Het
Slc43a2	T	C	11: 75,543,286	F97L	probably damaging	Het
Slc9a9	C	A	9: 95,229,054	Q642K	probably benign	Het
Soga3	T	C	10: 29,196,695	V661A	possibly damaging	Het
Sox6	G	T	7: 115,476,990	D804E	probably benign	Het
Terf2	A	G	8: 107,094,911	S176P	probably damaging	Het
Ttc6	A	T	12: 57,673,816	H956L	possibly damaging	Het
Tti2	T	C	8: 31,154,251	V292A	probably damaging	Het
Vmn1r29	A	T	6: 58,307,754	E153V	probably benign	Het
Vmn1r55	G	T	7: 5,146,670	H251Q	probably benign	Het
Yeats4	T	C	10: 117,215,681	T224A	probably benign	Het
Yipf4	T	A	17: 74,499,083	F239Y	probably benign	Het
Zan	T	C	5: 137,468,455	D380G	probably damaging	Het
Zbtb9	T	C	17: 26,974,920	F433S	probably damaging	Het
Zic5	T	C	14: 122,464,023	K432R	unknown	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACCCTGGATGTCAGAAGG -3'
(R):5'- TTCTGAGTCAGTGCAGTTGC -3'

Sequencing Primer
(F):5'- AGTTACACATCTGGGTGCC -3'
(R):5'- GCAGTTGCAGAGTTACAAGCATTC -3'

Posted On

2022-10-06