Incidental Mutation 'R0879:Klhl41'
ID81910
Institutional Source Beutler Lab
Gene Symbol Klhl41
Ensembl Gene ENSMUSG00000075307
Gene Namekelch-like 41
SynonymsLOC228003, Kbtbd10
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0879 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location69670120-69684230 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 69683483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073152] [ENSMUST00000100050] [ENSMUST00000102706]
Predicted Effect probably benign
Transcript: ENSMUST00000073152
SMART Domains Protein: ENSMUSP00000072896
Gene: ENSMUSG00000027086

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 560 628 6.6e-25 PFAM
Pfam:FAST_2 645 730 6.4e-26 PFAM
RAP 763 822 4.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100050
SMART Domains Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307

DomainStartEndE-ValueType
BTB 33 130 8.34e-27 SMART
BACK 135 237 9.67e-36 SMART
Kelch 346 398 6.71e-1 SMART
Kelch 399 447 1.56e-5 SMART
Kelch 448 495 2.43e-7 SMART
Kelch 496 542 5.81e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102706
SMART Domains Protein: ENSMUSP00000099767
Gene: ENSMUSG00000027086

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 530 600 2.2e-26 PFAM
Pfam:FAST_2 614 701 4.4e-31 PFAM
RAP 734 793 4.38e-25 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Klhl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Klhl41 APN 2 69674724 missense probably benign 0.00
IGL01622:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL01623:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL03237:Klhl41 APN 2 69670558 missense possibly damaging 0.94
R0220:Klhl41 UTSW 2 69670485 missense probably benign 0.25
R0277:Klhl41 UTSW 2 69671296 missense probably damaging 1.00
R0456:Klhl41 UTSW 2 69670549 missense probably damaging 0.99
R0485:Klhl41 UTSW 2 69671256 missense probably damaging 0.97
R0536:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0537:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0552:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0553:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0834:Klhl41 UTSW 2 69678147 missense possibly damaging 0.76
R1531:Klhl41 UTSW 2 69670740 missense probably benign 0.03
R1678:Klhl41 UTSW 2 69670939 missense probably benign 0.01
R1792:Klhl41 UTSW 2 69670802 missense probably benign 0.01
R1900:Klhl41 UTSW 2 69674619 splice site probably benign
R2012:Klhl41 UTSW 2 69683496 missense possibly damaging 0.61
R4041:Klhl41 UTSW 2 69670710 missense probably benign 0.00
R5223:Klhl41 UTSW 2 69679827 nonsense probably null
R5500:Klhl41 UTSW 2 69683529 missense probably damaging 1.00
R5643:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5644:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5656:Klhl41 UTSW 2 69683532 missense possibly damaging 0.89
R6264:Klhl41 UTSW 2 69679832 critical splice donor site probably null
R6678:Klhl41 UTSW 2 69670844 missense probably benign 0.04
R6731:Klhl41 UTSW 2 69674700 missense probably damaging 1.00
R7586:Klhl41 UTSW 2 69674724 missense probably benign 0.33
R7664:Klhl41 UTSW 2 69670717 missense probably damaging 1.00
R8158:Klhl41 UTSW 2 69671161 missense probably damaging 1.00
R8341:Klhl41 UTSW 2 69670524 missense probably benign 0.07
X0021:Klhl41 UTSW 2 69679706 missense probably damaging 1.00
Z1088:Klhl41 UTSW 2 69674730 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAAGAGCTATTTACCAGGCAGGCAC -3'
(R):5'- AACTGCGTGAATCCCTGTAACCC -3'

Sequencing Primer
(F):5'- AGGCAGGCACTTTGTCTGG -3'
(R):5'- GAATCCCTGTAACCCTATGTGAATC -3'
Posted On2013-11-08