Mutagenetix > Incidental Mutations

Incidental Mutation 'R0879:Col7a1'

81932

Institutional Source

Beutler Lab

Gene Symbol

Col7a1

Ensembl Gene

ENSMUSG00000025650

Gene Name

collagen, type VII, alpha 1

Synonyms

MMRRC Submission

039046-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0879 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108953586-108984875 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 108976091 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107701 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]

Predicted Effect

probably benign
Transcript: ENSMUST00000026740

SMART Domains

Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
VWA	37	217	1.56e-51	SMART
FN3	233	319	1.41e-10	SMART
FN3	325	405	6.54e-6	SMART
FN3	416	494	6.91e-5	SMART
FN3	509	585	1.24e-6	SMART
FN3	599	675	2.01e-6	SMART
FN3	687	763	7.45e-10	SMART
FN3	774	854	6.01e-5	SMART
FN3	865	944	7.23e-8	SMART
FN3	955	1038	2.16e-6	SMART
Pfam:VWA	1055	1227	2.3e-22	PFAM
Pfam:Collagen	1244	1311	2.4e-8	PFAM
Pfam:Collagen	1294	1355	4.1e-10	PFAM
low complexity region	1397	1414	N/A	INTRINSIC
Pfam:Collagen	1447	1504	1.3e-9	PFAM
Pfam:Collagen	1487	1547	5e-8	PFAM
low complexity region	1572	1595	N/A	INTRINSIC
low complexity region	1604	1632	N/A	INTRINSIC
Pfam:Collagen	1646	1714	2.8e-10	PFAM
Pfam:Collagen	1713	1775	1.9e-10	PFAM
low complexity region	1776	1794	N/A	INTRINSIC
low complexity region	1803	1833	N/A	INTRINSIC
Pfam:Collagen	1875	1935	1.5e-8	PFAM
Pfam:Collagen	1969	2033	2.4e-9	PFAM
Pfam:Collagen	2025	2092	9.1e-10	PFAM
Pfam:Collagen	2089	2158	1.3e-10	PFAM
Pfam:Collagen	2147	2209	1.6e-9	PFAM
Pfam:Collagen	2245	2312	1.4e-8	PFAM
Pfam:Collagen	2313	2365	2.5e-8	PFAM
Pfam:Collagen	2364	2423	7.3e-10	PFAM
Pfam:Collagen	2398	2457	1.5e-9	PFAM
Pfam:Collagen	2456	2515	8.4e-11	PFAM
Pfam:Collagen	2516	2572	1.9e-9	PFAM
Pfam:Collagen	2560	2630	7.2e-9	PFAM
Pfam:Collagen	2605	2682	6e-9	PFAM
Pfam:Collagen	2659	2722	2e-8	PFAM
low complexity region	2745	2775	N/A	INTRINSIC
Pfam:Kunitz_BPTI	2878	2932	3.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112070

SMART Domains

Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
VWA	37	217	1.56e-51	SMART
FN3	233	319	1.41e-10	SMART
FN3	325	405	6.54e-6	SMART
FN3	416	494	6.91e-5	SMART
FN3	509	585	1.24e-6	SMART
FN3	599	675	2.01e-6	SMART
FN3	687	763	7.45e-10	SMART
FN3	774	854	6.01e-5	SMART
FN3	865	944	7.23e-8	SMART
FN3	955	1038	2.16e-6	SMART
Pfam:VWA	1055	1230	2.2e-19	PFAM
Pfam:Collagen	1244	1311	2.5e-8	PFAM
Pfam:Collagen	1294	1355	4.2e-10	PFAM
low complexity region	1397	1414	N/A	INTRINSIC
Pfam:Collagen	1447	1504	1.3e-9	PFAM
Pfam:Collagen	1487	1547	5.1e-8	PFAM
low complexity region	1572	1595	N/A	INTRINSIC
low complexity region	1604	1632	N/A	INTRINSIC
Pfam:Collagen	1646	1714	2.9e-10	PFAM
Pfam:Collagen	1713	1775	1.9e-10	PFAM
low complexity region	1776	1794	N/A	INTRINSIC
low complexity region	1803	1833	N/A	INTRINSIC
Pfam:Collagen	1875	1935	1.5e-8	PFAM
Pfam:Collagen	1969	2033	2.5e-9	PFAM
Pfam:Collagen	2025	2092	9.4e-10	PFAM
Pfam:Collagen	2089	2158	1.3e-10	PFAM
Pfam:Collagen	2147	2209	1.6e-9	PFAM
Pfam:Collagen	2195	2266	7.7e-7	PFAM
Pfam:Collagen	2245	2312	1.4e-8	PFAM
Pfam:Collagen	2313	2365	2.6e-8	PFAM
Pfam:Collagen	2364	2423	7.6e-10	PFAM
Pfam:Collagen	2398	2457	1.5e-9	PFAM
Pfam:Collagen	2456	2515	8.7e-11	PFAM
Pfam:Collagen	2516	2572	2e-9	PFAM
Pfam:Collagen	2560	2630	7.4e-9	PFAM
Pfam:Collagen	2605	2682	6.2e-9	PFAM
Pfam:Collagen	2659	2722	2.1e-8	PFAM
Pfam:Collagen	2719	2778	1.6e-7	PFAM
Pfam:Kunitz_BPTI	2878	2932	1.1e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126780

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149142

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.9%
20x: 96.3%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aagab	T	A	9: 63,617,610		probably benign	Het
Adm	A	G	7: 110,628,352	D25G	possibly damaging	Het
Adprhl2	C	T	4: 126,316,617	V357I	probably benign	Het
Akap6	G	T	12: 52,880,799	R164L	probably damaging	Het
Baz2a	A	G	10: 128,121,304	N972S	probably damaging	Het
Brd2	A	T	17: 34,113,446	V232D	probably benign	Het
C6	A	G	15: 4,763,336		probably benign	Het
Ceacam5	A	C	7: 17,757,702	I666L	probably benign	Het
Dnah17	C	T	11: 118,056,835		probably benign	Het
Dnah7a	A	T	1: 53,427,860	V3615E	possibly damaging	Het
Eml6	A	G	11: 29,850,816		probably null	Het
Enpp2	T	C	15: 54,877,930	E324G	probably damaging	Het
Fgd4	A	G	16: 16,477,449	V222A	probably damaging	Het
Gm4076	A	G	13: 85,127,207		noncoding transcript	Het
Gm4775	T	C	14: 106,100,793		noncoding transcript	Het
Igsf9b	T	C	9: 27,333,742	S1002P	probably damaging	Het
Jag1	A	G	2: 137,100,081	S244P	possibly damaging	Het
Klhl41	A	T	2: 69,683,483		probably benign	Het
Ltbr	A	G	6: 125,313,375		probably benign	Het
Megf8	A	G	7: 25,338,471	E804G	possibly damaging	Het
Mybpc1	G	A	10: 88,571,516		probably benign	Het
Npas4	T	C	19: 4,986,916	R407G	probably benign	Het
Oxnad1	T	A	14: 32,099,596	Y213N	probably damaging	Het
Pde6d	A	G	1: 86,545,801	F91S	probably benign	Het
Pelp1	A	G	11: 70,395,297		probably benign	Het
Plscr2	T	C	9: 92,287,793	Y99H	probably damaging	Het
Rft1	T	C	14: 30,682,748		probably benign	Het
Ryr3	T	C	2: 113,030,243	Y30C	probably benign	Het
Selenbp2	A	G	3: 94,699,556	T108A	possibly damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Stra6	T	C	9: 58,135,204		probably null	Het
Usp17le	A	T	7: 104,769,647	L96Q	probably damaging	Het
Usp17le	G	T	7: 104,769,648	L96M	possibly damaging	Het
Vmn1r76	A	T	7: 11,930,735	I184N	probably benign	Het
Vmn2r102	T	C	17: 19,694,192	V673A	probably damaging	Het
Wdr17	T	G	8: 54,661,481	I667L	probably benign	Het
Zfp292	T	C	4: 34,811,218	T609A	probably benign	Het
Zfp821	T	C	8: 109,721,842	I135T	possibly damaging	Het
Zfp865	A	G	7: 5,031,343	T776A	probably benign	Het
Zp2	G	T	7: 120,135,534	P477Q	probably damaging	Het

Other mutations in Col7a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Col7a1	APN	9	108977697	nonsense	probably null
IGL01366:Col7a1	APN	9	108977119	splice site	probably benign
IGL01395:Col7a1	APN	9	108983912	unclassified	probably benign
IGL01410:Col7a1	APN	9	108964618	missense	unknown
IGL01902:Col7a1	APN	9	108977827	missense	unknown
IGL01915:Col7a1	APN	9	108955745	missense	unknown
IGL01936:Col7a1	APN	9	108967999	splice site	probably benign
IGL01943:Col7a1	APN	9	108984016	critical splice acceptor site	probably null
IGL02026:Col7a1	APN	9	108968029	missense	probably damaging	1.00
IGL02168:Col7a1	APN	9	108984075	unclassified	probably benign
IGL02504:Col7a1	APN	9	108980675	missense	unknown
IGL02510:Col7a1	APN	9	108973231	splice site	probably benign
IGL02559:Col7a1	APN	9	108973216	missense	unknown
IGL02583:Col7a1	APN	9	108962229	missense	unknown
IGL02728:Col7a1	APN	9	108984104	missense	probably benign	0.39
IGL03003:Col7a1	APN	9	108974956	critical splice donor site	probably null
IGL03096:Col7a1	APN	9	108955788	missense	unknown
IGL03122:Col7a1	APN	9	108961683	missense	unknown
IGL03212:Col7a1	APN	9	108974452	missense	unknown
IGL03240:Col7a1	APN	9	108968373	missense	probably null	1.00
IGL03355:Col7a1	APN	9	108978160	missense	unknown
olivetti	UTSW	9	108969961	missense	probably damaging	1.00
smallified	UTSW	9	108972813	critical splice donor site	probably null
underwood	UTSW	9	108968875	critical splice acceptor site	probably null
PIT4131001:Col7a1	UTSW	9	108965921	splice site	probably benign
R0007:Col7a1	UTSW	9	108961403	missense	unknown
R0007:Col7a1	UTSW	9	108961403	missense	unknown
R0078:Col7a1	UTSW	9	108974913	splice site	probably benign
R0091:Col7a1	UTSW	9	108967506	splice site	probably benign
R0126:Col7a1	UTSW	9	108969583	splice site	probably benign
R0244:Col7a1	UTSW	9	108972184	splice site	probably null
R0331:Col7a1	UTSW	9	108967502	splice site	probably benign
R0375:Col7a1	UTSW	9	108980237	missense	unknown
R0601:Col7a1	UTSW	9	108980584	splice site	probably benign
R0609:Col7a1	UTSW	9	108958147	missense	unknown
R0709:Col7a1	UTSW	9	108961548	splice site	probably benign
R1175:Col7a1	UTSW	9	108955334	missense	unknown
R1177:Col7a1	UTSW	9	108962441	missense	unknown
R1435:Col7a1	UTSW	9	108963273	missense	unknown
R1497:Col7a1	UTSW	9	108978825	missense	unknown
R1549:Col7a1	UTSW	9	108955966	missense	unknown
R1794:Col7a1	UTSW	9	108965928	missense	unknown
R1801:Col7a1	UTSW	9	108960997	missense	unknown
R1848:Col7a1	UTSW	9	108969565	missense	possibly damaging	0.83
R1899:Col7a1	UTSW	9	108978888	missense	unknown
R1944:Col7a1	UTSW	9	108960010	missense	unknown
R1945:Col7a1	UTSW	9	108960010	missense	unknown
R1955:Col7a1	UTSW	9	108955664	missense	unknown
R2009:Col7a1	UTSW	9	108968875	critical splice acceptor site	probably null
R2034:Col7a1	UTSW	9	108963007	missense	unknown
R3148:Col7a1	UTSW	9	108961405	missense	unknown
R3713:Col7a1	UTSW	9	108964440	nonsense	probably null
R4078:Col7a1	UTSW	9	108960991	missense	unknown
R4193:Col7a1	UTSW	9	108956672	missense	unknown
R4232:Col7a1	UTSW	9	108972813	critical splice donor site	probably null
R4528:Col7a1	UTSW	9	108959533	missense	unknown
R4771:Col7a1	UTSW	9	108971925	missense	probably damaging	0.99
R4820:Col7a1	UTSW	9	108968607	missense	possibly damaging	0.72
R4896:Col7a1	UTSW	9	108957277	missense	unknown
R4911:Col7a1	UTSW	9	108975219	missense	unknown
R4915:Col7a1	UTSW	9	108966464	missense	unknown
R4917:Col7a1	UTSW	9	108966464	missense	unknown
R5001:Col7a1	UTSW	9	108965078	critical splice donor site	probably null
R5352:Col7a1	UTSW	9	108961411	missense	unknown
R5361:Col7a1	UTSW	9	108963224	missense	unknown
R5730:Col7a1	UTSW	9	108972242	critical splice donor site	probably null
R5838:Col7a1	UTSW	9	108978143	missense	unknown
R5842:Col7a1	UTSW	9	108965815	missense	unknown
R5932:Col7a1	UTSW	9	108980211	missense	unknown
R6091:Col7a1	UTSW	9	108955334	missense	unknown
R6144:Col7a1	UTSW	9	108974080	missense	unknown
R6158:Col7a1	UTSW	9	108964603	missense	unknown
R6170:Col7a1	UTSW	9	108966443	missense	unknown
R6247:Col7a1	UTSW	9	108981062	unclassified	probably benign
R6338:Col7a1	UTSW	9	108956633	missense	unknown
R6339:Col7a1	UTSW	9	108956633	missense	unknown
R6382:Col7a1	UTSW	9	108975393	missense	unknown
R6518:Col7a1	UTSW	9	108955527	missense	unknown
R6533:Col7a1	UTSW	9	108961358	missense	unknown
R6569:Col7a1	UTSW	9	108978110	splice site	probably null
R6596:Col7a1	UTSW	9	108954341	unclassified	probably benign
R6697:Col7a1	UTSW	9	108970533	missense	probably damaging	1.00
R6753:Col7a1	UTSW	9	108958128	missense	unknown
R6849:Col7a1	UTSW	9	108975053	missense	unknown
R6915:Col7a1	UTSW	9	108967618	missense	probably benign	0.02
R6974:Col7a1	UTSW	9	108969426	missense	possibly damaging	0.82
R6991:Col7a1	UTSW	9	108983919	critical splice donor site	probably null
R7028:Col7a1	UTSW	9	108963263	nonsense	probably null
R7556:Col7a1	UTSW	9	108982465	splice site	probably null
R7571:Col7a1	UTSW	9	108982707	missense	probably null
R7815:Col7a1	UTSW	9	108969565	missense	probably damaging	0.96
R7875:Col7a1	UTSW	9	108958695	missense	unknown
R7931:Col7a1	UTSW	9	108980522	splice site	probably benign
R8016:Col7a1	UTSW	9	108958644	missense	unknown
R8038:Col7a1	UTSW	9	108957292	missense	unknown
R8049:Col7a1	UTSW	9	108975563	missense	unknown
R8098:Col7a1	UTSW	9	108956695	missense	unknown
R8103:Col7a1	UTSW	9	108975384	missense	unknown
R8128:Col7a1	UTSW	9	108955721	missense	unknown
R8268:Col7a1	UTSW	9	108972989	missense	unknown
R8274:Col7a1	UTSW	9	108969961	missense	probably damaging	1.00
R8318:Col7a1	UTSW	9	108958374	missense	unknown
RF008:Col7a1	UTSW	9	108964479	missense	unknown
X0023:Col7a1	UTSW	9	108984185	unclassified	probably benign
Z1088:Col7a1	UTSW	9	108978500	splice site	silent
Z1177:Col7a1	UTSW	9	108974923	missense	unknown
Z1177:Col7a1	UTSW	9	108976051	missense	unknown
Z1177:Col7a1	UTSW	9	108984077	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGATCCTCCACATTTGACCCTGGC -3'
(R):5'- GGCGTTCACAAGTATGGAAGTCCAC -3'

Sequencing Primer
(F):5'- CTTTAGGGAGCCAAAGGTGA -3'
(R):5'- TGTGTTCCAAGCAGAAACTTCC -3'

Posted On

2013-11-08