Incidental Mutation 'R1083:Phf1'
ID 84936
Institutional Source Beutler Lab
Gene Symbol Phf1
Ensembl Gene ENSMUSG00000024193
Gene Name PHD finger protein 1
Synonyms Tctex3, Tctex-3, D17Ertd455e, mPcl1, PHF2
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 26933127-26937890 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 26937270 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025027] [ENSMUST00000073724] [ENSMUST00000078961] [ENSMUST00000114935] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000229490]
AlphaFold Q9Z1B8
Predicted Effect probably benign
Transcript: ENSMUST00000025027
SMART Domains Protein: ENSMUSP00000025027
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:CutA1 67 165 6.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073724
SMART Domains Protein: ENSMUSP00000073402
Gene: ENSMUSG00000024193

DomainStartEndE-ValueType
TUDOR 29 86 5.61e-11 SMART
PHD 89 140 2.81e-8 SMART
PHD 188 238 2.42e0 SMART
low complexity region 410 416 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
Pfam:Mtf2_C 523 557 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078961
SMART Domains Protein: ENSMUSP00000077984
Gene: ENSMUSG00000024301

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
KISc 307 670 1.34e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114935
SMART Domains Protein: ENSMUSP00000110585
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CutA1 43 144 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184739
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229490
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the polycomb-like protein family, which is a component of polycomb repressive complex-2. This complex represses gene expression by catalyzing the trimethylation of histone H3 lysine 27 and is required for the regulation of developmental genes including homeotic genes. The gene is expressed primarily in testis tissue. Small interfering RNA-mediated knockdown in cultured cell lines results in changes in homeotic gene expression coincident with alterations in promoter methylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Phf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Phf1 APN 17 26936594 missense possibly damaging 0.90
IGL01629:Phf1 APN 17 26934273 missense probably benign 0.07
IGL01931:Phf1 APN 17 26935535 unclassified probably benign
IGL02008:Phf1 APN 17 26935286 missense possibly damaging 0.95
IGL02048:Phf1 APN 17 26934541 unclassified probably benign
IGL02206:Phf1 APN 17 26936869 unclassified probably benign
IGL02252:Phf1 APN 17 26935135 missense possibly damaging 0.65
IGL02548:Phf1 APN 17 26935626 missense probably damaging 1.00
IGL03145:Phf1 APN 17 26934370 critical splice donor site probably null
R0539:Phf1 UTSW 17 26934458 splice site probably null
R0815:Phf1 UTSW 17 26937140 unclassified probably benign
R0863:Phf1 UTSW 17 26937140 unclassified probably benign
R1028:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R1537:Phf1 UTSW 17 26935398 critical splice donor site probably null
R1587:Phf1 UTSW 17 26937492 missense probably damaging 0.99
R1656:Phf1 UTSW 17 26937359 missense possibly damaging 0.93
R1956:Phf1 UTSW 17 26935745 splice site probably null
R2566:Phf1 UTSW 17 26937088 missense probably damaging 1.00
R3196:Phf1 UTSW 17 26934455 missense probably damaging 1.00
R4223:Phf1 UTSW 17 26937500 nonsense probably null
R4835:Phf1 UTSW 17 26934678 missense probably benign
R6439:Phf1 UTSW 17 26936612 missense probably benign
R7070:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R7289:Phf1 UTSW 17 26935315 missense probably damaging 1.00
R7846:Phf1 UTSW 17 26935317 nonsense probably null
R8165:Phf1 UTSW 17 26937070 missense possibly damaging 0.95
X0028:Phf1 UTSW 17 26936188 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTGGATTGTTGTCCCAAAGAGCTG -3'
(R):5'- AACTAGGTACTGCACAGAGCCGTC -3'

Sequencing Primer
(F):5'- CTCTACCCAGCTTTGAGTATGTGAG -3'
(R):5'- GCACTCTTCGAGCAAGGAC -3'
Posted On 2013-11-18