Incidental Mutation 'R1421:Gls2'
ID 159823
Institutional Source Beutler Lab
Gene Symbol Gls2
Ensembl Gene ENSMUSG00000044005
Gene Name glutaminase 2 (liver, mitochondrial)
Synonyms Lga, A330074B06Rik
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 128194457-128210004 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 128201348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 253 (K253*)
Ref Sequence ENSEMBL: ENSMUSP00000047376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000123291] [ENSMUST00000143827] [ENSMUST00000159440]
AlphaFold Q571F8
Predicted Effect probably null
Transcript: ENSMUST00000044776
AA Change: K253*
SMART Domains Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: K253*

DomainStartEndE-ValueType
Pfam:Glutaminase 177 463 1.1e-116 PFAM
ANK 518 548 3.76e-5 SMART
ANK 552 581 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123385
Predicted Effect probably benign
Transcript: ENSMUST00000134104
SMART Domains Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 60 172 1e-48 PDB
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135441
Predicted Effect probably benign
Transcript: ENSMUST00000143827
SMART Domains Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 135 5e-25 PDB
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152928
Predicted Effect probably benign
Transcript: ENSMUST00000159440
SMART Domains Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 134 9e-25 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Gls2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gls2 APN 10 128200971 splice site probably null
IGL00583:Gls2 APN 10 128204882 missense probably benign 0.11
IGL01444:Gls2 APN 10 128201347 missense probably damaging 1.00
IGL02746:Gls2 APN 10 128200956 missense probably damaging 1.00
R0015:Gls2 UTSW 10 128209350 missense probably damaging 1.00
R0024:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R0378:Gls2 UTSW 10 128207311 missense probably benign
R1179:Gls2 UTSW 10 128199234 missense probably damaging 1.00
R1227:Gls2 UTSW 10 128199664 missense probably damaging 1.00
R1750:Gls2 UTSW 10 128201325 missense probably damaging 1.00
R1952:Gls2 UTSW 10 128209362 missense probably benign
R2218:Gls2 UTSW 10 128204714 missense probably damaging 1.00
R2291:Gls2 UTSW 10 128207610 nonsense probably null
R2382:Gls2 UTSW 10 128203842 missense probably damaging 1.00
R4536:Gls2 UTSW 10 128200937 missense probably benign 0.00
R5305:Gls2 UTSW 10 128204709 nonsense probably null
R5435:Gls2 UTSW 10 128195126 intron probably benign
R5767:Gls2 UTSW 10 128205221 missense probably damaging 1.00
R7223:Gls2 UTSW 10 128199194 missense probably benign
R7767:Gls2 UTSW 10 128195129 missense unknown
R8068:Gls2 UTSW 10 128195114 missense unknown
R8084:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R8329:Gls2 UTSW 10 128201285 missense probably benign 0.00
R8872:Gls2 UTSW 10 128204666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGGTGAGGAACAAAGTCTAGCCC -3'
(R):5'- GACGGATGTGGCAGCTATCACTAAC -3'

Sequencing Primer
(F):5'- GGAACAAAGTCTAGCCCCTTTTATG -3'
(R):5'- TATCTGCCTGGAGAACTGAAC -3'
Posted On 2014-03-14