Incidental Mutation 'R1558:Adamts9'
ID170415
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 92908711 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 399 (K399N)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113438
AA Change: K399N

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: K399N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
PIT4402001:Adamts9 UTSW 6 92872347 missense probably benign
PIT4458001:Adamts9 UTSW 6 92889905 missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0326:Adamts9 UTSW 6 92858057 nonsense probably null
R0396:Adamts9 UTSW 6 92798005 missense probably benign 0.00
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1433:Adamts9 UTSW 6 92849290 critical splice donor site probably null
R1661:Adamts9 UTSW 6 92880623 missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5384:Adamts9 UTSW 6 92798018 missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92863354 missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92909793 nonsense probably null
R7095:Adamts9 UTSW 6 92887691 missense probably benign 0.39
R7287:Adamts9 UTSW 6 92890003 missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92894289 missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92858121 missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92937338 missense probably benign 0.00
R7682:Adamts9 UTSW 6 92880698 missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92796238 missense probably damaging 1.00
R7791:Adamts9 UTSW 6 92872385 missense probably benign 0.00
RF013:Adamts9 UTSW 6 92943145 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CGTGAGCTATTGTGAAAGCTGTGC -3'
(R):5'- AACTAACCTTTCTGGGGCCAGGTG -3'

Sequencing Primer
(F):5'- CTTCACTAATGGAACAGCTTCGG -3'
(R):5'- CCATGCTTCACAAAGTTTGGG -3'
Posted On2014-04-13