Incidental Mutation 'R1638:Tnik'
ID173286
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1638 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28665740 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1254 (M1254V)
Ref Sequence ENSEMBL: ENSMUSP00000125081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: M1217V

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: M1217V

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159308
AA Change: M1170V

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: M1170V

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159680
AA Change: M1246V

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: M1246V

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159733
Predicted Effect probably damaging
Transcript: ENSMUST00000160307
AA Change: M1254V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: M1254V

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160518
AA Change: M1225V

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: M1225V

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161964
AA Change: M1162V
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: M1162V

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect possibly damaging
Transcript: ENSMUST00000162485
AA Change: M1199V

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: M1199V

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162777
AA Change: M1191V
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: M1191V

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192205
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
R7499:Tnik UTSW 3 28630594 missense possibly damaging 0.47
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGGTGCCTTTGACAAGAGC -3'
(R):5'- GATGGGCAACAACTCACAGCATTTG -3'

Sequencing Primer
(F):5'- accctggctgtcttagactc -3'
(R):5'- GAGCACCACATCCTTAGTGA -3'
Posted On2014-04-24