Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Kcnh2'

176615

Institutional Source

Beutler Lab

Gene Symbol

Kcnh2

Ensembl Gene

ENSMUSG00000038319

Gene Name

potassium voltage-gated channel, subfamily H (eag-related), member 2

Synonyms

merg1a, M-erg, Lqt2, ERG1, ether a go-go related, merg1b, LQT

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.565) question?

Stock #

R1608 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

24319589-24351604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24322219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 559 (T559A)

Ref Sequence

ENSEMBL: ENSMUSP00000110750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036092] [ENSMUST00000115098]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000036092
AA Change: T901A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000047705
Gene: ENSMUSG00000038319
AA Change: T901A

Domain	Start	End	E-Value	Type
PAS	13	87	9.54e0	SMART
PAC	93	135	1.31e-5	SMART
low complexity region	194	199	N/A	INTRINSIC
Pfam:Ion_trans	409	673	7.8e-38	PFAM
Pfam:Ion_trans_2	600	667	3.2e-13	PFAM
cNMP	744	862	1.15e-24	SMART
low complexity region	885	896	N/A	INTRINSIC
low complexity region	925	956	N/A	INTRINSIC
low complexity region	965	982	N/A	INTRINSIC
coiled coil region	1035	1069	N/A	INTRINSIC
low complexity region	1082	1108	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115098
AA Change: T559A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110750
Gene: ENSMUSG00000038319
AA Change: T559A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	114	319	1.4e-22	PFAM
Pfam:Ion_trans_2	257	325	2.9e-14	PFAM
cNMP	402	520	1.15e-24	SMART
low complexity region	543	554	N/A	INTRINSIC
low complexity region	583	614	N/A	INTRINSIC
low complexity region	623	640	N/A	INTRINSIC
coiled coil region	693	727	N/A	INTRINSIC
low complexity region	740	766	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142197

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice which maintain expression of the A isoform and lack expression of the B isoform are predisposed to episodic sinus bradycardia. Mice with mutations causing defects in both isoforms are embryonic lethal with defects in cardiac development and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Kcnh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Kcnh2	APN	5	24324966	missense	probably damaging	1.00
IGL01536:Kcnh2	APN	5	24326524	missense	probably damaging	1.00
IGL02305:Kcnh2	APN	5	24322660	missense	possibly damaging	0.86
IGL02379:Kcnh2	APN	5	24326638	missense	probably damaging	1.00
IGL03100:Kcnh2	APN	5	24322684	missense	probably damaging	1.00
IGL03326:Kcnh2	APN	5	24326413	missense	probably damaging	1.00
R0077:Kcnh2	UTSW	5	24322702	missense	probably benign	0.11
R0349:Kcnh2	UTSW	5	24351237	missense	probably benign	0.18
R0959:Kcnh2	UTSW	5	24322672	missense	probably damaging	1.00
R0960:Kcnh2	UTSW	5	24322672	missense	probably damaging	1.00
R0963:Kcnh2	UTSW	5	24322672	missense	probably damaging	1.00
R1130:Kcnh2	UTSW	5	24331825	nonsense	probably null
R1147:Kcnh2	UTSW	5	24324387	missense	probably damaging	1.00
R1147:Kcnh2	UTSW	5	24324387	missense	probably damaging	1.00
R1201:Kcnh2	UTSW	5	24322672	missense	probably damaging	1.00
R1346:Kcnh2	UTSW	5	24322660	missense	possibly damaging	0.86
R1613:Kcnh2	UTSW	5	24322762	splice site	probably benign
R1797:Kcnh2	UTSW	5	24322672	missense	probably damaging	1.00
R2006:Kcnh2	UTSW	5	24326570	missense	probably damaging	1.00
R2312:Kcnh2	UTSW	5	24324954	critical splice donor site	probably null
R2435:Kcnh2	UTSW	5	24326347	critical splice donor site	probably null
R4623:Kcnh2	UTSW	5	24348442	missense	probably benign	0.00
R4941:Kcnh2	UTSW	5	24331087	missense	probably damaging	0.98
R5394:Kcnh2	UTSW	5	24332041	missense	probably benign
R5467:Kcnh2	UTSW	5	24326767	nonsense	probably null
R6127:Kcnh2	UTSW	5	24325003	missense	probably damaging	1.00
R6135:Kcnh2	UTSW	5	24321793	missense	probably damaging	1.00
R6280:Kcnh2	UTSW	5	24331923	missense	probably benign	0.43
R6936:Kcnh2	UTSW	5	24324339	missense	probably damaging	1.00
R7061:Kcnh2	UTSW	5	24331922	missense	probably benign	0.01
R7136:Kcnh2	UTSW	5	24332991	missense	probably benign	0.13
R7399:Kcnh2	UTSW	5	24322059	missense	probably damaging	0.99
R7479:Kcnh2	UTSW	5	24325492	critical splice donor site	probably null
R7860:Kcnh2	UTSW	5	24324563	missense	probably damaging	1.00
R7950:Kcnh2	UTSW	5	24333036	missense	probably benign	0.31
R8018:Kcnh2	UTSW	5	24320016	missense	probably damaging	0.98
R8063:Kcnh2	UTSW	5	24321672	missense	probably benign	0.20
R8517:Kcnh2	UTSW	5	24326638	missense	probably damaging	1.00
R8681:Kcnh2	UTSW	5	24331983	missense	probably benign	0.03
R8992:Kcnh2	UTSW	5	24331870	missense	probably benign	0.00
R9260:Kcnh2	UTSW	5	24323071	missense	probably damaging	1.00
R9348:Kcnh2	UTSW	5	24333005	missense	probably damaging	1.00
R9349:Kcnh2	UTSW	5	24333005	missense	probably damaging	1.00
R9416:Kcnh2	UTSW	5	24332966	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATTGGACACCCCAGAGAAGGCAC -3'
(R):5'- ATGCCTCCCTTCCACTGGACAAAG -3'

Sequencing Primer
(F):5'- GGCCTACCTGACAAGGGATTAC -3'
(R):5'- GGCGCGAGATAAAACAACTTTG -3'

Posted On

2014-04-24