Incidental Mutation 'R1719:Ip6k1'
ID 191301
Institutional Source Beutler Lab
Gene Symbol Ip6k1
Ensembl Gene ENSMUSG00000032594
Gene Name inositol hexaphosphate kinase 1
Synonyms InsP6k1, Ihpk1, InsP6, 1200016D08Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.367) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107879847-107925981 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 107918195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 77 (E77K)
Ref Sequence ENSEMBL: ENSMUSP00000134754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000164395] [ENSMUST00000175874] [ENSMUST00000176566] [ENSMUST00000177158]
AlphaFold Q6PD10
Predicted Effect probably benign
Transcript: ENSMUST00000035214
AA Change: E176K

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594
AA Change: E176K

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167159
Predicted Effect probably benign
Transcript: ENSMUST00000175874
SMART Domains Protein: ENSMUSP00000135747
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect probably benign
Transcript: ENSMUST00000176566
Predicted Effect possibly damaging
Transcript: ENSMUST00000177158
AA Change: E77K

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134754
Gene: ENSMUSG00000032594
AA Change: E77K

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:IPK 108 206 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177396
Predicted Effect probably benign
Transcript: ENSMUST00000176613
Meta Mutation Damage Score 0.1415 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein may be responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired glucose tolerance, decreased insulin levels, bilateral epididymal aspermia, and testicular degeneration in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,904,526 (GRCm39) K263M probably damaging Het
Adam26a G A 8: 44,023,073 (GRCm39) T139M possibly damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Akap9 C T 5: 4,007,645 (GRCm39) Q238* probably null Het
Ankrd6 A T 4: 32,828,774 (GRCm39) V85E probably damaging Het
Ap2b1 C A 11: 83,215,430 (GRCm39) P125T probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cblc A T 7: 19,524,399 (GRCm39) D280E probably benign Het
Cdk11b T C 4: 155,732,854 (GRCm39) probably benign Het
Cela2a G T 4: 141,545,257 (GRCm39) F239L probably damaging Het
Cfap57 A T 4: 118,463,828 (GRCm39) C342S probably benign Het
Clca4a C A 3: 144,669,516 (GRCm39) W345L probably damaging Het
Col6a5 T C 9: 105,808,492 (GRCm39) D852G unknown Het
Cyp4a32 T C 4: 115,468,505 (GRCm39) V329A possibly damaging Het
Dcaf8 C T 1: 172,003,062 (GRCm39) P287S probably damaging Het
Dmxl1 T A 18: 50,067,704 (GRCm39) D2654E probably damaging Het
Dpep1 A T 8: 123,927,486 (GRCm39) I347F possibly damaging Het
Dtnb T A 12: 3,693,936 (GRCm39) Y56* probably null Het
Duox1 T C 2: 122,169,125 (GRCm39) Y1182H possibly damaging Het
Dusp10 T A 1: 183,769,422 (GRCm39) S129R probably benign Het
Dync2i1 T C 12: 116,219,532 (GRCm39) I137V probably benign Het
Epcam G A 17: 87,949,556 (GRCm39) R173Q probably damaging Het
Ephb3 A G 16: 21,039,400 (GRCm39) E384G probably damaging Het
Exosc10 A T 4: 148,652,960 (GRCm39) D525V probably damaging Het
Fam186a T A 15: 99,840,227 (GRCm39) T2006S possibly damaging Het
Fbxw21 T A 9: 108,977,242 (GRCm39) T156S possibly damaging Het
Fcrl5 A G 3: 87,364,704 (GRCm39) E568G probably damaging Het
Fmn2 C T 1: 174,436,024 (GRCm39) probably benign Het
Fut9 A G 4: 25,619,744 (GRCm39) F357L possibly damaging Het
Garre1 A T 7: 33,947,631 (GRCm39) M459K probably damaging Het
Gas2l1 G A 11: 5,014,266 (GRCm39) H65Y probably damaging Het
Gjd2 A T 2: 113,843,614 (GRCm39) M1K probably null Het
Hdgfl3 T C 7: 81,549,432 (GRCm39) Y149C probably damaging Het
Hmcn2 T C 2: 31,244,733 (GRCm39) V730A probably damaging Het
Inpp4a A T 1: 37,437,880 (GRCm39) S223C probably damaging Het
Knl1 T A 2: 118,902,219 (GRCm39) W1307R probably benign Het
Kpna3 A G 14: 61,624,926 (GRCm39) L139P probably damaging Het
Lama3 T C 18: 12,612,929 (GRCm39) probably null Het
Lin54 G A 5: 100,633,108 (GRCm39) P192L possibly damaging Het
Lpo T A 11: 87,700,018 (GRCm39) probably null Het
Lrrc37 T A 11: 103,507,897 (GRCm39) probably benign Het
Lrrd1 T G 5: 3,900,483 (GRCm39) probably null Het
Nbas T A 12: 13,610,978 (GRCm39) probably null Het
Nemp1 G A 10: 127,532,117 (GRCm39) G341D probably damaging Het
Nrp1 T C 8: 129,152,366 (GRCm39) F192L probably damaging Het
Nufip2 T A 11: 77,583,916 (GRCm39) V610E probably damaging Het
Nup160 T G 2: 90,530,780 (GRCm39) Y479* probably null Het
Oas1d A T 5: 121,058,025 (GRCm39) D323V possibly damaging Het
Or10ak14 A G 4: 118,610,797 (GRCm39) W315R possibly damaging Het
Or14j1 A G 17: 38,146,244 (GRCm39) D118G possibly damaging Het
Or4c3d T C 2: 89,882,128 (GRCm39) Y180C probably damaging Het
Or52e4 C A 7: 104,706,001 (GRCm39) H183N probably damaging Het
Or5ac22 T A 16: 59,135,069 (GRCm39) R234* probably null Het
Or8b3 G A 9: 38,314,550 (GRCm39) V127M possibly damaging Het
Or8c9 A T 9: 38,241,803 (GRCm39) T307S probably benign Het
Pcm1 T A 8: 41,766,396 (GRCm39) M1567K possibly damaging Het
Pdxk A G 10: 78,279,730 (GRCm39) V215A probably benign Het
Phf12 T A 11: 77,914,427 (GRCm39) L74Q probably damaging Het
Plcg1 A G 2: 160,595,663 (GRCm39) E537G probably null Het
Plxna2 C T 1: 194,326,678 (GRCm39) P204L possibly damaging Het
Ppp3cb T G 14: 20,574,131 (GRCm39) M236L probably benign Het
Qrsl1 A T 10: 43,772,026 (GRCm39) S55T probably damaging Het
Rbm5 T C 9: 107,621,112 (GRCm39) probably null Het
Sipa1l2 A G 8: 126,171,274 (GRCm39) S1403P probably damaging Het
Sis C T 3: 72,872,937 (GRCm39) C67Y probably damaging Het
Specc1 A G 11: 62,019,218 (GRCm39) I686V possibly damaging Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Sprtn C A 8: 125,628,372 (GRCm39) H154Q probably damaging Het
St7l A G 3: 104,778,303 (GRCm39) T147A probably benign Het
Stab1 G A 14: 30,867,985 (GRCm39) Q1630* probably null Het
Stpg2 A G 3: 138,937,960 (GRCm39) D173G probably benign Het
Tcf20 G A 15: 82,736,978 (GRCm39) T1491I probably benign Het
Themis2 A T 4: 132,516,960 (GRCm39) I180N possibly damaging Het
Timd5 T C 11: 46,417,121 (GRCm39) L13P probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Ttn A G 2: 76,638,340 (GRCm39) V13980A probably damaging Het
Ttn C T 2: 76,575,978 (GRCm39) V24972M probably damaging Het
Usp5 A T 6: 124,800,423 (GRCm39) M286K possibly damaging Het
Vmn2r22 G A 6: 123,614,802 (GRCm39) R263C possibly damaging Het
Vmn2r71 T G 7: 85,270,435 (GRCm39) C534G probably damaging Het
Wnk2 C T 13: 49,214,202 (GRCm39) S1460N possibly damaging Het
Zfp445 G A 9: 122,681,707 (GRCm39) P745S probably damaging Het
Zfp957 C T 14: 79,451,436 (GRCm39) G121D probably damaging Het
Zscan4f A G 7: 11,135,254 (GRCm39) E220G possibly damaging Het
Other mutations in Ip6k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Ip6k1 APN 9 107,923,082 (GRCm39) missense probably benign 0.01
R0147:Ip6k1 UTSW 9 107,923,093 (GRCm39) missense probably damaging 1.00
R1371:Ip6k1 UTSW 9 107,923,022 (GRCm39) missense probably damaging 0.96
R1530:Ip6k1 UTSW 9 107,922,761 (GRCm39) nonsense probably null
R1716:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1717:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1718:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1741:Ip6k1 UTSW 9 107,918,183 (GRCm39) missense probably benign 0.43
R1745:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1747:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1901:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1902:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1903:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R1962:Ip6k1 UTSW 9 107,918,287 (GRCm39) critical splice donor site probably null
R2126:Ip6k1 UTSW 9 107,918,195 (GRCm39) missense possibly damaging 0.89
R3809:Ip6k1 UTSW 9 107,923,086 (GRCm39) missense probably damaging 1.00
R5000:Ip6k1 UTSW 9 107,922,798 (GRCm39) nonsense probably null
R6074:Ip6k1 UTSW 9 107,901,308 (GRCm39) utr 5 prime probably benign
R6921:Ip6k1 UTSW 9 107,901,634 (GRCm39) missense probably damaging 1.00
R7069:Ip6k1 UTSW 9 107,922,651 (GRCm39) splice site probably null
R7154:Ip6k1 UTSW 9 107,922,861 (GRCm39) missense probably damaging 1.00
R7218:Ip6k1 UTSW 9 107,922,781 (GRCm39) missense unknown
R7330:Ip6k1 UTSW 9 107,922,452 (GRCm39) missense possibly damaging 0.56
R7731:Ip6k1 UTSW 9 107,921,927 (GRCm39) missense probably damaging 1.00
R7736:Ip6k1 UTSW 9 107,922,891 (GRCm39) missense probably damaging 1.00
R7765:Ip6k1 UTSW 9 107,909,288 (GRCm39) missense possibly damaging 0.52
R7941:Ip6k1 UTSW 9 107,901,631 (GRCm39) missense probably damaging 1.00
R8221:Ip6k1 UTSW 9 107,923,115 (GRCm39) missense probably benign 0.40
R8383:Ip6k1 UTSW 9 107,921,926 (GRCm39) missense possibly damaging 0.81
R8815:Ip6k1 UTSW 9 107,918,211 (GRCm39) missense probably benign 0.38
X0021:Ip6k1 UTSW 9 107,909,389 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTGTCCCTAAAGGTGACTTC -3'
(R):5'- TTTTCCCCAGTGGAACCCATGC -3'

Sequencing Primer
(F):5'- AAAGGTGACTTCTCTGATCTCTTAGC -3'
(R):5'- AACCCATGCCCCTGTGAG -3'
Posted On 2014-05-14