Mutagenetix > Incidental Mutation

Incidental Mutation 'R3847:Garnl3'

277408

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

MMRRC Submission

040895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 32992228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 832 (H832N)

Ref Sequence

ENSEMBL: ENSMUSP00000122576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]

AlphaFold

Q3V0G7

Predicted Effect

probably benign
Transcript: ENSMUST00000049618
AA Change: H791N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: H791N

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	202	383	3.4e-73	PFAM
Pfam:CNH	475	780	3.5e-67	PFAM
low complexity region	793	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102810
AA Change: H787N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: H787N

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	198	385	4.6e-67	PFAM
Pfam:CNH	471	776	1.8e-68	PFAM
low complexity region	789	800	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137381
AA Change: H832N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Blvra	C	T	2: 127,095,191	T188I	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cul9	T	C	17: 46,525,135	Y1195C	probably damaging	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gad2	T	G	2: 22,684,988	D472E	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Hhip	T	A	8: 79,997,495	M373L	probably benign	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0551:Garnl3	UTSW	2	33016738	missense	probably damaging	1.00
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0737:Garnl3	UTSW	2	32990642	missense	probably damaging	0.98
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1691:Garnl3	UTSW	2	32997663	nonsense	probably null
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6267:Garnl3	UTSW	2	33104880	missense	probably benign	0.20
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7002:Garnl3	UTSW	2	33054193	missense	possibly damaging	0.65
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
R7746:Garnl3	UTSW	2	32992257	missense	probably damaging	1.00
R7919:Garnl3	UTSW	2	33046599	missense	probably benign	0.38
R8079:Garnl3	UTSW	2	33018499	critical splice donor site	probably null
R8087:Garnl3	UTSW	2	33045536	missense	probably benign	0.01
R8123:Garnl3	UTSW	2	33104938	missense	probably damaging	0.97
R8170:Garnl3	UTSW	2	33015223	missense	possibly damaging	0.88
R8347:Garnl3	UTSW	2	33085891	missense	probably damaging	1.00
R8418:Garnl3	UTSW	2	33052146	missense	possibly damaging	0.73
R8679:Garnl3	UTSW	2	33026094	missense	probably damaging	1.00
R8940:Garnl3	UTSW	2	33005229	critical splice acceptor site	probably null
R9081:Garnl3	UTSW	2	33006908	missense	possibly damaging	0.90
R9183:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9213:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9219:Garnl3	UTSW	2	33085886	missense	probably damaging	1.00
R9453:Garnl3	UTSW	2	33003869	missense	probably damaging	1.00
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTGTAGCTCTGACAATAACCC -3'
(R):5'- TGAGACTCCTGAGGGAAGTG -3'

Sequencing Primer
(F):5'- TGTAGCTCTGACAATAACCCTAAGAC -3'
(R):5'- ACCTTGGGAAATATGATATGGCTG -3'

Posted On

2015-04-06