Incidental Mutation 'R7126:Spag17'
ID552310
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7126 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100101435 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1960 (N1960K)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect probably benign
Transcript: ENSMUST00000164539
AA Change: N1960K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: N1960K

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acadsb T C 7: 131,437,448 I316T probably benign Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Cbs T A 17: 31,619,139 M379L probably benign Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Fam129a T A 1: 151,714,567 C537* probably null Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Grid2 T A 6: 64,076,810 V331E probably damaging Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Klhl12 A G 1: 134,467,783 H161R probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1355 T C 10: 78,879,577 V135A possibly damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Plin1 T C 7: 79,726,664 probably null Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scn7a G T 2: 66,757,286 H24Q possibly damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm4 A T 7: 45,310,709 probably null Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Ubr2 A T 17: 46,974,056 probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
R7772:Spag17 UTSW 3 100080118 missense probably damaging 0.98
R7842:Spag17 UTSW 3 100053858 missense probably benign 0.18
R7925:Spag17 UTSW 3 100053858 missense probably benign 0.18
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Z1176:Spag17 UTSW 3 100012993 missense probably benign 0.18
Z1177:Spag17 UTSW 3 100088399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAGAAATCTATGTCTCTTGC -3'
(R):5'- ACACCAACGTATCTGTAGCATG -3'

Sequencing Primer
(F):5'- GTCTCTTGCAGAATTAGTTGTCAACC -3'
(R):5'- CTGTAGCATGTAGCCAACAGCATG -3'
Posted On2019-05-15