Incidental Mutation 'R1819:Gli3'
ID204732
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission 039847-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1819 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 15725792 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1255 (Q1255*)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
Predicted Effect probably null
Transcript: ENSMUST00000110510
AA Change: Q1255*
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: Q1255*

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,981,056 probably null Het
Abhd17a T C 10: 80,586,636 T71A probably benign Het
Acad11 G A 9: 104,114,539 probably null Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afdn A G 17: 13,850,848 T783A probably damaging Het
Akap13 T A 7: 75,608,705 M359K probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atl1 T C 12: 69,963,300 S547P probably benign Het
Bace1 A T 9: 45,857,162 T252S possibly damaging Het
BC034090 A G 1: 155,225,829 S230P possibly damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Capn8 T A 1: 182,598,826 I242N probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc180 A G 4: 45,926,195 E1135G possibly damaging Het
Ccdc181 C T 1: 164,282,478 Q385* probably null Het
Cdh10 G T 15: 18,991,965 G437* probably null Het
Ceacam1 T A 7: 25,463,860 Q316L possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cers4 T A 8: 4,521,232 M267K probably benign Het
Csmd3 T C 15: 47,753,735 D1930G possibly damaging Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dus2 T A 8: 106,051,848 W377R probably damaging Het
E330034G19Rik A G 14: 24,298,013 D111G probably damaging Het
Erich4 C T 7: 25,615,290 R66Q possibly damaging Het
Fcgbp G T 7: 28,085,283 R256L probably benign Het
Fdxr A T 11: 115,276,104 F53Y probably damaging Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Foxo3 A T 10: 42,197,611 D84E probably benign Het
Gin1 A G 1: 97,785,226 probably null Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Gpr171 T C 3: 59,097,920 I145V probably benign Het
Gpr68 T A 12: 100,878,403 H294L possibly damaging Het
Gys2 T C 6: 142,461,186 E148G probably damaging Het
Heatr5b T C 17: 78,791,511 D1320G probably damaging Het
Ifnlr1 G T 4: 135,686,523 probably benign Het
Ift88 G A 14: 57,455,519 E392K probably damaging Het
Igsf9b T A 9: 27,311,593 S97T probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kcnj11 C T 7: 46,099,156 G248S probably benign Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Lilrb4a A G 10: 51,496,028 Y205C probably damaging Het
Lima1 T A 15: 99,819,936 H63L probably benign Het
Lonrf3 A G X: 36,358,708 I687V probably damaging Het
Lrba A G 3: 86,542,634 T2099A possibly damaging Het
Morn5 C T 2: 36,052,975 T29M probably damaging Het
Neurl1b G A 17: 26,438,700 R22H probably benign Het
Nr2e3 T C 9: 59,943,437 I380V probably damaging Het
Oas1c G A 5: 120,808,735 A10V possibly damaging Het
Olfr395 T C 11: 73,906,679 E271G probably benign Het
Olfr671 C T 7: 104,975,398 V196I probably benign Het
P3h3 T C 6: 124,854,932 T297A probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Plec C T 15: 76,179,906 R2056Q probably damaging Het
Plxna2 T A 1: 194,790,186 N1079K probably benign Het
Prr12 G C 7: 45,048,697 probably benign Het
Psip1 A G 4: 83,458,163 S480P probably benign Het
Ptpre A G 7: 135,668,993 probably benign Het
Pvalb A C 15: 78,202,584 V44G probably damaging Het
Rab3c T G 13: 110,084,135 Q164P possibly damaging Het
Rubcn T C 16: 32,826,914 K703R possibly damaging Het
Setd7 T G 3: 51,542,639 H122P probably benign Het
Slc26a8 A T 17: 28,684,834 F19I probably benign Het
Slc6a14 A G X: 21,741,047 D625G probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Syngr3 A G 17: 24,687,722 F40L possibly damaging Het
Syt8 G A 7: 142,438,234 G21R possibly damaging Het
Tagln A G 9: 45,930,840 F152L probably benign Het
Tcf12 G A 9: 72,109,717 T36M probably damaging Het
Tdrd6 C T 17: 43,626,551 S1202N probably benign Het
Tekt2 T C 4: 126,323,736 K179E probably damaging Het
Tekt4 G T 17: 25,473,811 probably null Het
Tmprss5 G T 9: 49,107,164 R98L probably benign Het
Tns1 G T 1: 73,916,476 probably benign Het
Tpcn1 A C 5: 120,536,227 probably null Het
Ttc6 T C 12: 57,694,500 probably null Het
Ttf1 A G 2: 29,074,784 N706S possibly damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr17 A T 8: 54,690,124 S140T probably benign Het
Wdr19 A T 5: 65,212,891 I123F possibly damaging Het
Zer1 C T 2: 30,110,218 A317T probably benign Het
Zfp474 A G 18: 52,638,800 D175G probably damaging Het
Zfp598 T C 17: 24,681,130 probably benign Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
R7228:Gli3 UTSW 13 15724502 missense probably benign 0.00
R7327:Gli3 UTSW 13 15725559 missense probably benign 0.02
R7451:Gli3 UTSW 13 15726291 missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15726256 missense probably benign 0.00
R8167:Gli3 UTSW 13 15725643 missense probably benign 0.00
R8170:Gli3 UTSW 13 15720208 missense probably benign
R8199:Gli3 UTSW 13 15725991 missense probably benign 0.08
R8247:Gli3 UTSW 13 15726775 missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15713548 missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15723525 missense probably damaging 1.00
R8559:Gli3 UTSW 13 15660132 missense probably damaging 1.00
R8676:Gli3 UTSW 13 15715034 missense probably damaging 1.00
R8905:Gli3 UTSW 13 15726531 missense probably benign 0.01
RF010:Gli3 UTSW 13 15726369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAAGCTGAAGTGTGGTC -3'
(R):5'- TGTTGCCAGCTAACTCATTTGG -3'

Sequencing Primer
(F):5'- TGGGCTATACAACAATATGGTGGTAC -3'
(R):5'- AACTCATTTGGTGCCACGGAC -3'
Posted On2014-06-23