Incidental Mutation 'R1838:Naip6'
ID 205537
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene Name NLR family, apoptosis inhibitory protein 6
Synonyms Naip-rs4, Birc1f, Naip-rs4A
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100417629-100453124 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100452644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000112867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
AlphaFold Q9JIB6
Predicted Effect probably damaging
Transcript: ENSMUST00000042220
AA Change: D139G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: D139G

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118574
AA Change: D139G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: D139G

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Lamc3 T C 2: 31,815,594 (GRCm39) S1097P possibly damaging Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Pms1 A C 1: 53,231,257 (GRCm39) probably null Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Ralyl A G 3: 14,208,472 (GRCm39) E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc16a7 C T 10: 125,067,067 (GRCm39) V191M probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Smpd4 G A 16: 17,460,166 (GRCm39) probably null Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Spata31d1b G A 13: 59,863,671 (GRCm39) C273Y probably benign Het
Spata31d1b G A 13: 59,865,279 (GRCm39) R809K probably benign Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100,452,525 (GRCm39) missense probably benign 0.03
IGL01123:Naip6 APN 13 100,440,946 (GRCm39) missense probably benign 0.02
IGL01151:Naip6 APN 13 100,435,601 (GRCm39) missense probably benign 0.00
IGL01382:Naip6 APN 13 100,436,364 (GRCm39) missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100,439,798 (GRCm39) missense probably benign 0.17
IGL01654:Naip6 APN 13 100,435,853 (GRCm39) missense probably benign 0.00
IGL01662:Naip6 APN 13 100,436,862 (GRCm39) missense probably damaging 1.00
IGL01726:Naip6 APN 13 100,439,760 (GRCm39) missense probably benign 0.02
IGL01810:Naip6 APN 13 100,424,603 (GRCm39) splice site probably benign
IGL01867:Naip6 APN 13 100,436,820 (GRCm39) missense probably benign 0.40
IGL01926:Naip6 APN 13 100,436,704 (GRCm39) missense probably damaging 1.00
IGL01964:Naip6 APN 13 100,435,238 (GRCm39) splice site probably benign
IGL02145:Naip6 APN 13 100,433,486 (GRCm39) missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100,435,933 (GRCm39) missense probably benign 0.01
IGL02214:Naip6 APN 13 100,452,567 (GRCm39) missense probably damaging 1.00
IGL02342:Naip6 APN 13 100,439,748 (GRCm39) missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100,452,780 (GRCm39) missense probably damaging 1.00
IGL02573:Naip6 APN 13 100,435,979 (GRCm39) nonsense probably null
IGL02680:Naip6 APN 13 100,420,256 (GRCm39) missense probably benign
IGL02829:Naip6 APN 13 100,437,273 (GRCm39) missense probably benign 0.11
IGL02833:Naip6 APN 13 100,436,121 (GRCm39) missense probably damaging 1.00
IGL02851:Naip6 APN 13 100,437,168 (GRCm39) missense probably benign 0.01
IGL02860:Naip6 APN 13 100,436,984 (GRCm39) missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100,436,984 (GRCm39) missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100,452,932 (GRCm39) missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100,439,745 (GRCm39) missense probably benign 0.00
R0310:Naip6 UTSW 13 100,444,721 (GRCm39) missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100,433,432 (GRCm39) missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100,438,768 (GRCm39) missense probably benign 0.02
R0560:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R0638:Naip6 UTSW 13 100,437,036 (GRCm39) missense probably benign 0.00
R0792:Naip6 UTSW 13 100,420,274 (GRCm39) missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100,452,983 (GRCm39) missense probably benign 0.11
R1102:Naip6 UTSW 13 100,440,923 (GRCm39) missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100,436,870 (GRCm39) missense probably damaging 1.00
R1462:Naip6 UTSW 13 100,436,748 (GRCm39) missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100,436,748 (GRCm39) missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100,452,983 (GRCm39) missense probably benign
R1595:Naip6 UTSW 13 100,435,602 (GRCm39) missense probably damaging 0.96
R1749:Naip6 UTSW 13 100,444,763 (GRCm39) missense probably benign 0.03
R1863:Naip6 UTSW 13 100,437,067 (GRCm39) missense probably benign 0.03
R1914:Naip6 UTSW 13 100,435,936 (GRCm39) missense probably benign 0.13
R2001:Naip6 UTSW 13 100,437,237 (GRCm39) missense probably benign 0.44
R2082:Naip6 UTSW 13 100,440,852 (GRCm39) splice site probably null
R2143:Naip6 UTSW 13 100,436,367 (GRCm39) missense probably damaging 1.00
R2174:Naip6 UTSW 13 100,435,495 (GRCm39) missense probably benign
R2266:Naip6 UTSW 13 100,420,067 (GRCm39) missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R2285:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R2286:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R2351:Naip6 UTSW 13 100,420,169 (GRCm39) missense probably damaging 1.00
R2363:Naip6 UTSW 13 100,452,928 (GRCm39) missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100,437,176 (GRCm39) missense probably damaging 0.99
R2971:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R2975:Naip6 UTSW 13 100,424,695 (GRCm39) missense probably damaging 1.00
R3081:Naip6 UTSW 13 100,436,961 (GRCm39) missense probably benign
R3082:Naip6 UTSW 13 100,452,925 (GRCm39) missense probably benign 0.00
R3122:Naip6 UTSW 13 100,453,031 (GRCm39) missense probably benign 0.00
R3417:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R3943:Naip6 UTSW 13 100,431,247 (GRCm39) missense probably benign 0.01
R3944:Naip6 UTSW 13 100,431,247 (GRCm39) missense probably benign 0.01
R4080:Naip6 UTSW 13 100,435,815 (GRCm39) missense probably damaging 1.00
R4166:Naip6 UTSW 13 100,452,657 (GRCm39) missense probably benign 0.23
R4396:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R4397:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R4418:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R4512:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R4670:Naip6 UTSW 13 100,431,239 (GRCm39) critical splice donor site probably null
R4671:Naip6 UTSW 13 100,431,239 (GRCm39) critical splice donor site probably null
R4722:Naip6 UTSW 13 100,443,580 (GRCm39) missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100,422,299 (GRCm39) missense probably damaging 1.00
R4900:Naip6 UTSW 13 100,433,477 (GRCm39) missense probably damaging 0.99
R5162:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R5316:Naip6 UTSW 13 100,420,290 (GRCm39) missense probably benign 0.00
R5403:Naip6 UTSW 13 100,436,585 (GRCm39) missense probably benign 0.12
R5437:Naip6 UTSW 13 100,439,812 (GRCm39) nonsense probably null
R5507:Naip6 UTSW 13 100,435,423 (GRCm39) missense probably benign 0.01
R5631:Naip6 UTSW 13 100,436,646 (GRCm39) missense probably benign 0.02
R5657:Naip6 UTSW 13 100,436,909 (GRCm39) missense probably benign
R5684:Naip6 UTSW 13 100,436,888 (GRCm39) missense probably damaging 1.00
R5786:Naip6 UTSW 13 100,436,724 (GRCm39) missense probably benign
R5787:Naip6 UTSW 13 100,436,724 (GRCm39) missense probably benign
R5788:Naip6 UTSW 13 100,436,724 (GRCm39) missense probably benign
R5878:Naip6 UTSW 13 100,436,181 (GRCm39) missense probably damaging 1.00
R5895:Naip6 UTSW 13 100,452,500 (GRCm39) missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100,435,829 (GRCm39) missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100,435,794 (GRCm39) missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100,444,741 (GRCm39) missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R6321:Naip6 UTSW 13 100,436,909 (GRCm39) missense probably benign
R6402:Naip6 UTSW 13 100,437,226 (GRCm39) missense probably benign 0.30
R6435:Naip6 UTSW 13 100,431,249 (GRCm39) missense probably benign 0.04
R6477:Naip6 UTSW 13 100,452,516 (GRCm39) missense probably damaging 1.00
R6601:Naip6 UTSW 13 100,420,266 (GRCm39) missense probably benign
R6638:Naip6 UTSW 13 100,436,909 (GRCm39) missense probably benign
R6639:Naip6 UTSW 13 100,436,909 (GRCm39) missense probably benign
R6804:Naip6 UTSW 13 100,435,675 (GRCm39) missense probably benign
R6922:Naip6 UTSW 13 100,438,706 (GRCm39) missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100,452,773 (GRCm39) missense probably damaging 1.00
R7050:Naip6 UTSW 13 100,452,007 (GRCm39) missense probably damaging 1.00
R7135:Naip6 UTSW 13 100,436,927 (GRCm39) missense probably damaging 1.00
R7140:Naip6 UTSW 13 100,436,708 (GRCm39) missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100,452,657 (GRCm39) missense probably benign 0.23
R7196:Naip6 UTSW 13 100,436,666 (GRCm39) missense probably benign 0.10
R7234:Naip6 UTSW 13 100,452,011 (GRCm39) nonsense probably null
R7259:Naip6 UTSW 13 100,440,863 (GRCm39) missense probably damaging 1.00
R7322:Naip6 UTSW 13 100,435,896 (GRCm39) missense possibly damaging 0.94
R7332:Naip6 UTSW 13 100,437,209 (GRCm39) missense possibly damaging 0.62
R7339:Naip6 UTSW 13 100,452,527 (GRCm39) missense probably damaging 1.00
R7353:Naip6 UTSW 13 100,436,259 (GRCm39) missense probably benign 0.00
R7485:Naip6 UTSW 13 100,420,359 (GRCm39) missense probably benign 0.07
R7597:Naip6 UTSW 13 100,437,108 (GRCm39) missense probably benign 0.08
R7835:Naip6 UTSW 13 100,452,512 (GRCm39) missense probably benign 0.19
R7840:Naip6 UTSW 13 100,451,979 (GRCm39) missense probably damaging 1.00
R8082:Naip6 UTSW 13 100,436,961 (GRCm39) missense probably benign
R8082:Naip6 UTSW 13 100,436,909 (GRCm39) missense probably benign
R8103:Naip6 UTSW 13 100,437,851 (GRCm39) missense probably benign 0.00
R8164:Naip6 UTSW 13 100,452,797 (GRCm39) missense probably benign 0.00
R8206:Naip6 UTSW 13 100,431,344 (GRCm39) nonsense probably null
R8258:Naip6 UTSW 13 100,452,920 (GRCm39) missense probably benign 0.02
R8259:Naip6 UTSW 13 100,452,920 (GRCm39) missense probably benign 0.02
R8348:Naip6 UTSW 13 100,436,894 (GRCm39) missense possibly damaging 0.61
R8405:Naip6 UTSW 13 100,436,784 (GRCm39) missense possibly damaging 0.89
R8406:Naip6 UTSW 13 100,436,784 (GRCm39) missense possibly damaging 0.89
R8441:Naip6 UTSW 13 100,422,265 (GRCm39) missense possibly damaging 0.77
R8448:Naip6 UTSW 13 100,436,894 (GRCm39) missense possibly damaging 0.61
R8465:Naip6 UTSW 13 100,433,423 (GRCm39) missense possibly damaging 0.95
R8501:Naip6 UTSW 13 100,436,784 (GRCm39) missense possibly damaging 0.89
R8502:Naip6 UTSW 13 100,436,784 (GRCm39) missense possibly damaging 0.89
R8687:Naip6 UTSW 13 100,435,636 (GRCm39) missense probably benign 0.10
R8806:Naip6 UTSW 13 100,437,161 (GRCm39) missense possibly damaging 0.93
R9186:Naip6 UTSW 13 100,436,390 (GRCm39) missense possibly damaging 0.89
R9340:Naip6 UTSW 13 100,452,494 (GRCm39) missense probably damaging 1.00
R9352:Naip6 UTSW 13 100,437,893 (GRCm39) missense possibly damaging 0.85
R9585:Naip6 UTSW 13 100,436,577 (GRCm39) missense probably damaging 0.96
R9597:Naip6 UTSW 13 100,436,646 (GRCm39) missense probably benign 0.02
R9601:Naip6 UTSW 13 100,436,961 (GRCm39) missense probably benign
X0066:Naip6 UTSW 13 100,451,970 (GRCm39) nonsense probably null
Z1177:Naip6 UTSW 13 100,437,308 (GRCm39) missense probably damaging 1.00
Z1177:Naip6 UTSW 13 100,435,925 (GRCm39) missense probably benign 0.20
Z1177:Naip6 UTSW 13 100,452,638 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTCAATACCTCAGAAATGCCTC -3'
(R):5'- TGACACGTTCAGATCATGGAC -3'

Sequencing Primer
(F):5'- TCAGAAATGCCTCACAAAATGG -3'
(R):5'- GTTCAGATCATGGACGCCACAG -3'
Posted On 2014-06-23