Incidental Mutation 'R1838:Dnah7b'
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
MMRRC Submission 039865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1838 (G1)
Quality Score225
Status Not validated
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46116177 bp
Amino Acid Change Valine to Alanine at position 295 (V295A)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect probably benign
Transcript: ENSMUST00000069293
AA Change: V295A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: V295A

coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,727 D22G unknown Het
Abca4 G A 3: 122,128,305 R1170K probably benign Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adamtsl3 G T 7: 82,493,373 R267L probably damaging Het
Adgrb2 A T 4: 130,010,231 T717S probably benign Het
Adgrb3 A G 1: 25,084,270 S1417P probably damaging Het
Afg3l2 A T 18: 67,414,172 V561D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Btnl6 T A 17: 34,515,542 D82V probably damaging Het
Ccdc178 A G 18: 22,067,638 Y421H probably damaging Het
Cdc123 A T 2: 5,794,891 probably null Het
Cdhr5 C T 7: 141,272,603 V367I possibly damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Ctnna2 T C 6: 77,845,542 D26G probably damaging Het
Ctr9 G T 7: 111,052,303 R910L possibly damaging Het
Cyp2t4 G T 7: 27,158,416 R455L possibly damaging Het
Cyp3a13 A T 5: 137,911,632 probably null Het
Dennd3 T C 15: 73,565,100 S1059P probably damaging Het
Dennd4c A G 4: 86,825,178 T1135A probably benign Het
Ehbp1l1 C T 19: 5,717,691 E1195K probably benign Het
Exoc6b T A 6: 84,853,678 I447L probably benign Het
Glt1d1 G A 5: 127,678,129 V202I probably benign Het
Grk1 T C 8: 13,416,155 V533A possibly damaging Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Gzma T A 13: 113,095,984 I131F probably damaging Het
Helq A T 5: 100,771,879 L35* probably null Het
Hnrnpll T C 17: 80,038,623 N403S probably damaging Het
Hsf5 A G 11: 87,636,055 K518E probably benign Het
Ighe T A 12: 113,271,850 H258L unknown Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Ints13 C T 6: 146,566,611 A129T possibly damaging Het
Ipo7 T A 7: 110,042,109 H345Q probably damaging Het
Kcna2 A T 3: 107,104,512 E136D probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krtap4-9 A G 11: 99,785,396 probably benign Het
Lamc3 T C 2: 31,925,582 S1097P possibly damaging Het
Ldlrad2 A T 4: 137,572,170 N114K probably benign Het
Lrfn1 A T 7: 28,459,768 I371L probably damaging Het
Lrwd1 A G 5: 136,132,388 V240A probably benign Het
Lypd1 A T 1: 125,873,371 probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Man2c1 A G 9: 57,137,337 N354S probably benign Het
Map3k13 T C 16: 21,914,189 Y514H possibly damaging Het
Med15 T C 16: 17,653,562 D577G probably benign Het
Mroh4 A T 15: 74,616,113 M320K probably benign Het
Ms4a10 T A 19: 10,964,047 D186V possibly damaging Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Myo5c A T 9: 75,273,553 R741S probably damaging Het
Naip6 T C 13: 100,316,136 D139G probably damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Olfr1252 A T 2: 89,721,709 M134K probably damaging Het
Olfr1370 A T 13: 21,072,425 L292* probably null Het
Olfr229 A T 9: 39,909,841 I13F possibly damaging Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Pcdhb3 A G 18: 37,301,317 D112G probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Pgm3 C T 9: 86,569,233 V123I probably benign Het
Pms1 A C 1: 53,192,098 probably null Het
Prl2b1 A G 13: 27,388,566 S14P possibly damaging Het
Prune2 T A 19: 17,199,878 W212R probably damaging Het
Rabgef1 A G 5: 130,213,021 E422G probably benign Het
Ralyl A G 3: 14,143,412 E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,651,680 probably benign Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Slc16a7 C T 10: 125,231,198 V191M probably damaging Het
Slc34a2 A T 5: 53,058,436 H63L probably benign Het
Smpd4 G A 16: 17,642,302 probably null Het
Sp3 A G 2: 72,938,176 S748P possibly damaging Het
Spata31d1b G A 13: 59,715,857 C273Y probably benign Het
Spata31d1b G A 13: 59,717,465 R809K probably benign Het
Tmco5 A T 2: 116,880,879 E90V probably damaging Het
Tnxb A T 17: 34,678,910 D844V probably damaging Het
Tpi1 T C 6: 124,814,152 T41A probably benign Het
Ttn T C 2: 76,727,192 I29853V probably damaging Het
Vmn2r26 C T 6: 124,024,771 T5I probably benign Het
Wdr95 A G 5: 149,599,366 D663G probably benign Het
Zbtb39 T C 10: 127,742,700 F381S probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp646 T A 7: 127,879,739 Y363N probably damaging Het
Zfp712 A C 13: 67,042,047 C139G probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
BB001:Dnah7b UTSW 1 46219430 missense probably benign 0.04
BB011:Dnah7b UTSW 1 46219430 missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 splice site probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46290734 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46356554 missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46124346 missense probably benign 0.06
R7547:Dnah7b UTSW 1 46214413 missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46268634 missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46109302 missense probably benign
R7676:Dnah7b UTSW 1 46234164 nonsense probably null
R7731:Dnah7b UTSW 1 46139745 missense probably benign 0.00
R7760:Dnah7b UTSW 1 46201253 missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46137474 missense probably benign
R7807:Dnah7b UTSW 1 46214367 missense probably benign
R7895:Dnah7b UTSW 1 46249950 missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46139678 missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46219430 missense probably benign 0.04
R7944:Dnah7b UTSW 1 46227003 missense probably benign
R7946:Dnah7b UTSW 1 46233579 missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46243424 missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46243365 missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46224706 nonsense probably null
R8094:Dnah7b UTSW 1 46126804 missense probably benign 0.01
R8137:Dnah7b UTSW 1 46233753 missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46253511 missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46356576 missense probably benign 0.43
R8309:Dnah7b UTSW 1 46139872 missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46175296 missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46356659 critical splice donor site probably null
R8438:Dnah7b UTSW 1 46188679 missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46290715 missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46099490 missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46116200 missense possibly damaging 0.94
RF020:Dnah7b UTSW 1 46373261 missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-23