Mutagenetix > Incidental Mutation

Incidental Mutation 'R1823:Itgam'

206579

Institutional Source

Beutler Lab

Gene Symbol

Itgam

Ensembl Gene

ENSMUSG00000030786

Gene Name

integrin alpha M

Synonyms

Mac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3

MMRRC Submission

039851-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R1823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128062640-128118491 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128064732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 44 (T44S)

Ref Sequence

ENSEMBL: ENSMUSP00000121676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355] [ENSMUST00000156593]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000064821
AA Change: T44S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: T44S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
Pfam:Integrin_alpha	1130	1144	2.1e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082743

Predicted Effect

probably benign
Transcript: ENSMUST00000098015
AA Change: T44S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: T44S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
coiled coil region	1143	1170	N/A	INTRINSIC
low complexity region	1178	1200	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106240
AA Change: T44S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: T44S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	462	516	3.67e-3	SMART
low complexity region	732	738	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106242
AA Change: T44S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: T44S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
Pfam:Integrin_alpha	1131	1145	8.4e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119696

SMART Domains

Protein: ENSMUSP00000113412
Gene: ENSMUSG00000030786

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
PDB:3K72\|C	17	79	2e-17	PDB
SCOP:d1m1xa4	17	81	6e-18	SMART
Blast:Int_alpha	30	79	5e-29	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000120355
AA Change: T44S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: T44S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
low complexity region	1141	1150	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156593
AA Change: T44S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000121676
Gene: ENSMUSG00000030786
AA Change: T44S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
PDB:3K72\|C	17	79	2e-17	PDB
SCOP:d1m1xa4	17	81	9e-18	SMART
Blast:Int_alpha	30	79	3e-29	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.6%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	C	15: 84,406,468	T213A	probably benign	Het
Adcy1	G	A	11: 7,161,312	V868I	probably benign	Het
Ahnak	G	T	19: 9,004,905	M1184I	probably damaging	Het
Akap11	T	C	14: 78,511,488	E1153G	probably damaging	Het
Amy1	T	C	3: 113,562,727	N260S	probably null	Het
Ankrd6	A	G	4: 32,824,427	L129P	probably damaging	Het
Aox2	A	T	1: 58,312,359	T702S	probably benign	Het
Apobec1	G	T	6: 122,578,886	T204K	possibly damaging	Het
Arhgef19	A	G	4: 141,249,146	R433G	probably benign	Het
Atf6b	T	A	17: 34,648,644	H110Q	possibly damaging	Het
Btnl4	C	T	17: 34,475,852		probably null	Het
Camsap2	T	C	1: 136,273,783	T662A	possibly damaging	Het
Cbs	G	A	17: 31,624,271	H229Y	probably damaging	Het
Cct8	G	A	16: 87,490,554	R111*	probably null	Het
Cdc42bpb	C	T	12: 111,327,559	A250T	probably damaging	Het
Chrd	A	G	16: 20,741,347		probably benign	Het
Ckap2l	A	G	2: 129,275,579	F559L	probably damaging	Het
D630003M21Rik	T	C	2: 158,217,557	Y141C	probably damaging	Het
Dbf4	T	C	5: 8,397,539	N557S	probably benign	Het
Dct	T	G	14: 118,036,523	N324T	probably benign	Het
Dip2a	A	T	10: 76,278,502	L999*	probably null	Het
Dock10	T	A	1: 80,543,097		probably null	Het
Dync2li1	A	T	17: 84,649,797	D330V	probably damaging	Het
Eif4g3	T	A	4: 138,180,491	D1267E	probably benign	Het
Enc1	A	G	13: 97,245,978	E332G	possibly damaging	Het
Fat2	C	T	11: 55,256,780	V3879I	probably benign	Het
Fh1	A	T	1: 175,616,548	I117K	probably damaging	Het
Fkbp15	A	G	4: 62,337,091	L227P	probably damaging	Het
Fpr1	T	A	17: 17,877,053	M225L	probably benign	Het
Fras1	A	T	5: 96,770,688	I3528F	probably damaging	Het
Grm7	A	G	6: 111,207,769	T354A	probably benign	Het
Ift27	T	A	15: 78,173,778	I9F	possibly damaging	Het
Igf1r	A	G	7: 68,194,981	D834G	possibly damaging	Het
Igsf9b	T	A	9: 27,331,732	L738Q	probably damaging	Het
Ivd	T	A	2: 118,862,034	I5N	probably benign	Het
Jcad	T	C	18: 4,675,780	S1181P	probably damaging	Het
Kctd18	A	G	1: 57,956,365	V251A	probably benign	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo18a	T	C	11: 77,825,097		probably benign	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myocd	C	A	11: 65,178,670	M909I	probably benign	Het
Ndufv3	G	A	17: 31,531,245	R467Q	probably damaging	Het
Nkpd1	G	A	7: 19,523,252	V319M	probably damaging	Het
Olfr1216	A	G	2: 89,013,378	S229P	probably benign	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Olfr1453	C	A	19: 13,027,817	V171L	probably benign	Het
Olfr31	T	A	14: 14,328,774	L221Q	probably damaging	Het
Olfr366	T	C	2: 37,220,332	V281A	probably damaging	Het
Olfr406	C	T	11: 74,270,217	A276V	probably damaging	Het
Olfr450	G	T	6: 42,818,268	A266S	possibly damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pcdhb9	A	G	18: 37,402,818	T622A	probably benign	Het
Pdpk1	A	T	17: 24,098,176		probably benign	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	G	T	10: 3,903,658		probably null	Het
Plekhh2	A	G	17: 84,575,189	Y708C	probably damaging	Het
Pnp	T	C	14: 50,950,329	F107L	probably damaging	Het
Postn	T	A	3: 54,385,287		probably null	Het
Prcp	A	T	7: 92,928,675	D349V	probably damaging	Het
Prl3a1	A	T	13: 27,270,194	I52F	probably damaging	Het
Pym1	G	A	10: 128,766,044		probably benign	Het
Rad9a	A	T	19: 4,197,242	I248N	probably damaging	Het
Ror2	T	G	13: 53,110,305	E917A	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sema6d	A	G	2: 124,659,556		probably null	Het
Slc4a2	C	T	5: 24,427,620	A12V	probably damaging	Het
Slco6b1	T	G	1: 96,961,176		noncoding transcript	Het
Slf2	A	T	19: 44,935,248	H167L	possibly damaging	Het
Snx9	G	T	17: 5,920,671	G429V	probably damaging	Het
Sod3	G	T	5: 52,368,162	V68L	probably benign	Het
Spta1	T	A	1: 174,246,549	D2351E	probably benign	Het
Srpk3	G	A	X: 73,777,955	R425Q	possibly damaging	Het
Tatdn1	C	T	15: 58,916,156	G171E	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnfsf9	A	G	17: 57,105,738	T103A	probably benign	Het
Tpm3-rs7	T	C	14: 113,315,163	L163P	possibly damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Ucp1	C	T	8: 83,294,032	T157I	probably damaging	Het
Uspl1	T	A	5: 149,214,414	L794Q	probably benign	Het
Vmn1r5	T	A	6: 56,985,595	V85E	probably damaging	Het
Vmn1r58	A	G	7: 5,410,406	I275T	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,872	I820M	probably damaging	Het
Wscd1	C	A	11: 71,760,218	P124T	probably benign	Het
Zfp780b	A	T	7: 27,963,100	C677S	possibly damaging	Het

Other mutations in Itgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Itgam	APN	7	128085661	missense	probably damaging	1.00
IGL00983:Itgam	APN	7	128068667	missense	probably damaging	0.97
IGL01102:Itgam	APN	7	128080273	missense	possibly damaging	0.94
IGL01615:Itgam	APN	7	128116767	missense	possibly damaging	0.80
IGL01845:Itgam	APN	7	128112472	missense	probably damaging	1.00
IGL01860:Itgam	APN	7	128070943	missense	probably benign	0.03
IGL01874:Itgam	APN	7	128115166	missense	probably damaging	0.97
IGL01910:Itgam	APN	7	128083776	missense	probably damaging	1.00
IGL01994:Itgam	APN	7	128101727	missense	probably damaging	0.97
IGL02332:Itgam	APN	7	128085674	critical splice donor site	probably null
IGL02348:Itgam	APN	7	128116300	missense	possibly damaging	0.52
IGL02394:Itgam	APN	7	128084942	missense	probably benign	0.01
IGL02491:Itgam	APN	7	128116018	missense	possibly damaging	0.71
IGL02695:Itgam	APN	7	128085941	missense	possibly damaging	0.81
IGL02821:Itgam	APN	7	128076109	missense	probably damaging	0.99
IGL02970:Itgam	APN	7	128086043	missense	probably benign	0.00
IGL03145:Itgam	APN	7	128113019	missense	probably benign	0.12
adhesion	UTSW	7	128101537	missense	probably damaging	0.99
apparition	UTSW	7	128112286	splice site	probably null
attachment	UTSW	7	128113033	missense	probably damaging	1.00
Follower	UTSW	7	128080264	missense	probably damaging	1.00
invisible	UTSW	7	128070703	splice site	probably null
obscured	UTSW	7	128081634	missense	probably damaging	1.00
R0184:Itgam	UTSW	7	128086058	missense	probably damaging	0.96
R0389:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0443:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0454:Itgam	UTSW	7	128107980	missense	probably benign	0.01
R0674:Itgam	UTSW	7	128116218	missense	possibly damaging	0.67
R0828:Itgam	UTSW	7	128116505	critical splice donor site	probably null
R0925:Itgam	UTSW	7	128112238	missense	probably benign	0.00
R1086:Itgam	UTSW	7	128080264	missense	probably damaging	1.00
R1655:Itgam	UTSW	7	128115163	missense	probably benign	0.00
R1809:Itgam	UTSW	7	128070937	missense	possibly damaging	0.62
R2105:Itgam	UTSW	7	128081712	missense	probably damaging	1.00
R2154:Itgam	UTSW	7	128085577	missense	probably damaging	0.99
R2656:Itgam	UTSW	7	128116815	missense	probably null	1.00
R2913:Itgam	UTSW	7	128112406	missense	probably damaging	1.00
R3116:Itgam	UTSW	7	128116029	missense	probably damaging	1.00
R3404:Itgam	UTSW	7	128070703	splice site	probably null
R3821:Itgam	UTSW	7	128112286	splice site	probably null
R3822:Itgam	UTSW	7	128112286	splice site	probably null
R3960:Itgam	UTSW	7	128115175	missense	probably benign	0.02
R3968:Itgam	UTSW	7	128113033	missense	probably damaging	1.00
R4192:Itgam	UTSW	7	128064732	missense	probably benign	0.21
R4400:Itgam	UTSW	7	128081658	missense	probably damaging	1.00
R4708:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4709:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4742:Itgam	UTSW	7	128113073	missense	probably damaging	1.00
R4790:Itgam	UTSW	7	128116273	missense	probably benign	0.01
R4960:Itgam	UTSW	7	128115840	missense	possibly damaging	0.93
R5109:Itgam	UTSW	7	128113218	missense	probably benign	0.06
R5190:Itgam	UTSW	7	128116317	splice site	probably null
R5379:Itgam	UTSW	7	128112388	missense	probably damaging	1.00
R5386:Itgam	UTSW	7	128107980	missense	probably benign	0.00
R6104:Itgam	UTSW	7	128116302	missense	possibly damaging	0.85
R6122:Itgam	UTSW	7	128085652	missense	probably damaging	0.99
R6189:Itgam	UTSW	7	128112504	missense	probably benign	0.04
R6282:Itgam	UTSW	7	128084942	missense	probably benign	0.01
R6545:Itgam	UTSW	7	128107872	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACGGGTGGAAATGTGTGT -3'
(R):5'- ACTCCTGAAACCTTACTACTGATT -3'

Sequencing Primer
(F):5'- GGAAATGTGTGTTGTTCTCTTAACC -3'
(R):5'- GAGCATCTGCAAACCTTGGATTC -3'

Posted On

2014-06-23