Mutagenetix > Incidental Mutation

Incidental Mutation 'R1848:Slc4a10'

207851

Institutional Source

Beutler Lab

Gene Symbol

Slc4a10

Ensembl Gene

ENSMUSG00000026904

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter-like, member 10

Synonyms

NCBE

MMRRC Submission

039873-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1848 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62046462-62326730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62316606 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 1090 (K1090M)

Ref Sequence

ENSEMBL: ENSMUSP00000108099 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]

AlphaFold

Q5DTL9

Predicted Effect

probably damaging
Transcript: ENSMUST00000054484
AA Change: K1060M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: K1060M

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	9e-107	PFAM
Pfam:HCO3_cotransp	445	959	1e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102735
AA Change: K1060M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: K1060M

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	2e-106	PFAM
Pfam:HCO3_cotransp	445	959	2.4e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112480
AA Change: K1090M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: K1090M

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	435	9.6e-108	PFAM
Pfam:HCO3_cotransp	476	989	1.5e-245	PFAM
transmembrane domain	997	1019	N/A	INTRINSIC
low complexity region	1041	1055	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156534

Meta Mutation Damage Score

0.6368

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

98% (120/123)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933402J07Rik	C	A	8: 87,568,493	Y86*	probably null	Het
Aadac	A	G	3: 60,039,697	E272G	probably damaging	Het
Abcc8	A	T	7: 46,166,902	D271E	probably benign	Het
Acan	T	C	7: 79,099,035	F1185L	probably benign	Het
Adam1a	A	T	5: 121,519,620	C537S	probably damaging	Het
Ago2	A	G	15: 73,123,965	V395A	probably benign	Het
Alox15	A	G	11: 70,350,752	V101A	probably damaging	Het
Ankra2	T	C	13: 98,271,124	I194T	probably damaging	Het
Apobec4	C	A	1: 152,756,230	P3H	probably damaging	Het
Arid3b	G	T	9: 57,796,677	Y329*	probably null	Het
Atm	A	T	9: 53,468,012	S1993T	probably benign	Het
Bpgm	T	G	6: 34,487,734	S129A	probably benign	Het
Brat1	A	G	5: 140,718,509	D839G	possibly damaging	Het
Ccdc15	A	T	9: 37,342,570	S128T	probably benign	Het
Cd300lg	A	T	11: 102,046,206		probably benign	Het
Cdc34b	C	A	11: 94,742,477	Q168K	probably damaging	Het
Celsr2	A	T	3: 108,401,310	V1767E	probably benign	Het
Cep350	T	C	1: 155,953,651	D169G	probably benign	Het
Col7a1	A	T	9: 108,969,565	D1762V	possibly damaging	Het
Coro7	A	G	16: 4,630,434	L724P	probably damaging	Het
Crb1	T	A	1: 139,237,012	I1125F	probably damaging	Het
Ctif	T	A	18: 75,519,941	D415V	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dhrs2	A	G	14: 55,240,841	D237G	probably benign	Het
Dhx9	T	C	1: 153,465,753	Q582R	probably damaging	Het
Dnajc1	C	T	2: 18,219,713	R443Q	probably damaging	Het
Dnm2	C	T	9: 21,505,681	R837W	possibly damaging	Het
Dpf2	C	A	19: 5,906,615	Q70H	probably damaging	Het
Dqx1	T	A	6: 83,066,107	D608E	probably damaging	Het
Dync2h1	T	A	9: 7,049,166	T3245S	probably benign	Het
Ect2l	A	G	10: 18,200,033	L35P	probably damaging	Het
Efcab5	A	T	11: 77,103,306	L1285Q	probably damaging	Het
Eif4g1	G	C	16: 20,681,867	R697P	probably damaging	Het
Emsy	T	A	7: 98,600,821	E753V	probably damaging	Het
Entpd3	A	G	9: 120,558,419	I227M	probably damaging	Het
Epn1	T	A	7: 5,089,998	V103E	probably damaging	Het
Esrra	T	C	19: 6,912,010	D337G	probably benign	Het
Fam129c	T	C	8: 71,603,769	M371T	possibly damaging	Het
Fam83e	A	T	7: 45,728,770	K406M	possibly damaging	Het
Fam83e	A	T	7: 45,728,769	K406*	probably null	Het
Fat2	A	G	11: 55,311,558	I230T	probably damaging	Het
Fbxl16	A	G	17: 25,816,446	I6V	probably benign	Het
Fgf23	T	C	6: 127,073,193	I55T	probably damaging	Het
Fibcd1	T	A	2: 31,821,549	D288V	probably damaging	Het
Flnb	T	C	14: 7,892,113	I594T	probably damaging	Het
Gabbr2	T	C	4: 46,739,823	E449G	probably benign	Het
Gbf1	T	G	19: 46,272,037	S1130A	possibly damaging	Het
Gipc3	T	C	10: 81,341,265	E157G	probably damaging	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm6625	A	C	8: 89,146,834		noncoding transcript	Het
Gpx4	A	G	10: 80,056,036		probably benign	Het
Grb10	A	G	11: 11,946,029	F264L	possibly damaging	Het
Grik3	T	C	4: 125,694,138	Y684H	probably damaging	Het
Gstp1	C	T	19: 4,036,795		probably benign	Het
Haus8	G	A	8: 71,256,123		probably benign	Het
Hip1	G	A	5: 135,435,141		probably null	Het
Hist3h2ba	A	T	11: 58,949,102	I55F	possibly damaging	Het
Hspbap1	T	A	16: 35,818,764		probably null	Het
Htr2b	T	A	1: 86,099,429	I452F	possibly damaging	Het
Hydin	T	A	8: 110,569,808	H3656Q	probably benign	Het
Klb	T	A	5: 65,348,837	D142E	probably benign	Het
Lamb3	A	T	1: 193,334,616	T777S	possibly damaging	Het
Lins1	C	A	7: 66,714,322	T650K	probably damaging	Het
Loxhd1	A	G	18: 77,281,971	K5R	possibly damaging	Het
Lpp	G	A	16: 24,761,655	M40I	probably damaging	Het
Mia2	A	T	12: 59,170,251		probably benign	Het
Miip	A	C	4: 147,863,092	F204V	probably damaging	Het
Mmp21	T	C	7: 133,677,153	R323G	probably benign	Het
Mta3	T	A	17: 83,755,551		probably benign	Het
Myh1	A	G	11: 67,213,630	K1004R	probably benign	Het
Myh14	T	A	7: 44,632,429	I810F	probably damaging	Het
Nbas	A	C	12: 13,413,597	D1295A	probably damaging	Het
Npr2	T	G	4: 43,632,384	V67G	probably benign	Het
Oas1f	C	A	5: 120,855,429	Q235K	probably damaging	Het
Olfr109	T	A	17: 37,467,047	S280R	probably damaging	Het
Olfr59	G	T	11: 74,289,213	C189F	probably damaging	Het
Olfr60	T	A	7: 140,345,987	M1L	probably benign	Het
Olfr629	T	C	7: 103,741,174	N22S	probably benign	Het
Olfr857	C	T	9: 19,713,090	H88Y	probably benign	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Pde1b	A	G	15: 103,525,340		probably null	Het
Pdilt	T	C	7: 119,489,384	T465A	probably benign	Het
Plxnd1	T	C	6: 115,966,546	H1233R	probably damaging	Het
Ppm1b	T	A	17: 84,994,124	M144K	probably benign	Het
Prkdc	T	C	16: 15,808,058	L3316S	probably benign	Het
Prm2	T	A	16: 10,791,591		probably benign	Het
Prmt7	T	C	8: 106,237,008	V240A	probably benign	Het
Prx	C	A	7: 27,518,888	A938E	possibly damaging	Het
Rbm7	A	G	9: 48,490,894	V131A	probably benign	Het
Ric1	T	A	19: 29,600,813		probably null	Het
Rnf150	A	T	8: 82,864,010	M1L	possibly damaging	Het
Rnf20	C	T	4: 49,644,628	R298W	probably damaging	Het
Rp1	T	A	1: 4,347,232	Y1219F	possibly damaging	Het
Scn7a	A	G	2: 66,684,013		probably null	Het
Sdad1	A	G	5: 92,292,651		probably null	Het
Sept9	T	C	11: 117,353,083		probably benign	Het
Serinc3	T	C	2: 163,645,489		probably benign	Het
Shc3	C	T	13: 51,461,388	G178R	probably damaging	Het
Slco1a1	T	C	6: 141,923,111	I376V	probably benign	Het
Slmap	A	T	14: 26,422,574	F719L	probably benign	Het
Smgc	A	G	15: 91,859,758	N573D	possibly damaging	Het
Spx	G	A	6: 142,414,079		probably null	Het
Srrt	C	G	5: 137,296,945	E308Q	probably damaging	Het
Tas2r130	T	A	6: 131,630,597	R78S	probably benign	Het
Tchhl1	A	G	3: 93,471,101	R371G	probably damaging	Het
Teddm2	C	T	1: 153,850,448	A174T	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Trim33	T	C	3: 103,324,640		probably benign	Het
Tspan31	A	G	10: 127,069,458	V40A	probably damaging	Het
Uevld	A	G	7: 46,945,227		probably benign	Het
Vcl	G	T	14: 21,008,995	A560S	probably benign	Het
Vmn2r24	T	A	6: 123,816,224	C837S	probably damaging	Het
Vmn2r57	C	T	7: 41,428,107	V212M	probably damaging	Het
Vps13c	A	G	9: 67,936,340	T1968A	probably benign	Het
Vtn	A	G	11: 78,500,567	R269G	probably damaging	Het
Wdcp	G	A	12: 4,850,245	V34I	possibly damaging	Het
Zc3h14	A	G	12: 98,752,832	D152G	possibly damaging	Het
Zfp189	C	T	4: 49,529,266	P123L	probably benign	Het
Zfp318	T	C	17: 46,406,055	S1038P	possibly damaging	Het
Zfp873	A	G	10: 82,060,572	D416G	probably benign	Het

Other mutations in Slc4a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Slc4a10	APN	2	62290001	missense	probably damaging	1.00
IGL00990:Slc4a10	APN	2	62286940	missense	probably damaging	1.00
IGL01294:Slc4a10	APN	2	62253309	critical splice acceptor site	probably null
IGL01628:Slc4a10	APN	2	62268666	missense	probably damaging	1.00
IGL01773:Slc4a10	APN	2	62190757	missense	probably damaging	0.97
IGL02119:Slc4a10	APN	2	62228670	missense	probably damaging	1.00
IGL02125:Slc4a10	APN	2	62268171	missense	probably benign	0.02
IGL02406:Slc4a10	APN	2	62190769	missense	probably benign	0.37
IGL02890:Slc4a10	APN	2	62286916	missense	probably damaging	1.00
IGL02959:Slc4a10	APN	2	62268143	missense	probably damaging	1.00
IGL02979:Slc4a10	APN	2	62288747	missense	probably null	1.00
IGL03144:Slc4a10	APN	2	62250466	missense	probably benign	0.00
IGL03175:Slc4a10	APN	2	62296960	missense	probably damaging	0.99
IGL03383:Slc4a10	APN	2	62267436	missense	probably damaging	1.00
IGL03412:Slc4a10	APN	2	62250543	splice site	probably benign
R0085:Slc4a10	UTSW	2	62244346	splice site	probably benign
R0401:Slc4a10	UTSW	2	62190848	missense	probably benign	0.27
R0433:Slc4a10	UTSW	2	62289983	missense	probably benign	0.01
R0482:Slc4a10	UTSW	2	62297017	splice site	probably benign
R0506:Slc4a10	UTSW	2	62250533	missense	probably benign	0.13
R0511:Slc4a10	UTSW	2	62286862	missense	probably damaging	0.97
R0590:Slc4a10	UTSW	2	62190893	splice site	probably benign
R0883:Slc4a10	UTSW	2	62243398	missense	probably benign	0.11
R1167:Slc4a10	UTSW	2	62228574	missense	probably damaging	1.00
R1276:Slc4a10	UTSW	2	62250443	missense	probably damaging	0.99
R1395:Slc4a10	UTSW	2	62313286	missense	probably benign	0.00
R1455:Slc4a10	UTSW	2	62286930	missense	probably damaging	1.00
R1589:Slc4a10	UTSW	2	62257462	missense	probably damaging	1.00
R1677:Slc4a10	UTSW	2	62324727	missense	probably benign
R1987:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R1988:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R2018:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2019:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2407:Slc4a10	UTSW	2	62313343	missense	probably benign
R4067:Slc4a10	UTSW	2	62046645	start codon destroyed	probably benign	0.00
R4184:Slc4a10	UTSW	2	62317442	intron	probably benign
R4255:Slc4a10	UTSW	2	62281936	missense	probably benign	0.10
R4282:Slc4a10	UTSW	2	62244343	splice site	probably null
R4296:Slc4a10	UTSW	2	62234428	missense	possibly damaging	0.80
R4361:Slc4a10	UTSW	2	62243385	missense	probably benign	0.00
R4596:Slc4a10	UTSW	2	62296858	missense	probably damaging	1.00
R4709:Slc4a10	UTSW	2	62257517	missense	probably null	1.00
R4755:Slc4a10	UTSW	2	62296988	missense	probably damaging	1.00
R4836:Slc4a10	UTSW	2	62268187	missense	probably damaging	1.00
R4841:Slc4a10	UTSW	2	62257595	missense	possibly damaging	0.68
R4998:Slc4a10	UTSW	2	62244439	missense	probably benign	0.00
R5069:Slc4a10	UTSW	2	62267571	missense	probably benign	0.06
R5223:Slc4a10	UTSW	2	62253366	missense	probably damaging	1.00
R5244:Slc4a10	UTSW	2	62288725	missense	probably damaging	1.00
R5386:Slc4a10	UTSW	2	62290058	missense	probably damaging	1.00
R5808:Slc4a10	UTSW	2	62250472	missense	probably damaging	1.00
R5999:Slc4a10	UTSW	2	62243431	missense	probably benign	0.10
R6007:Slc4a10	UTSW	2	62268872	missense	probably benign	0.44
R6009:Slc4a10	UTSW	2	62046690	missense	probably benign	0.00
R6015:Slc4a10	UTSW	2	62228702	missense	probably benign	0.05
R6103:Slc4a10	UTSW	2	62234465	missense	probably damaging	1.00
R6141:Slc4a10	UTSW	2	62211445	missense	probably damaging	1.00
R6193:Slc4a10	UTSW	2	62243357	splice site	probably null
R6217:Slc4a10	UTSW	2	62303951	missense	probably benign	0.27
R6280:Slc4a10	UTSW	2	62281966	missense	probably benign	0.05
R6523:Slc4a10	UTSW	2	62286961	nonsense	probably null
R6643:Slc4a10	UTSW	2	62228710	missense	possibly damaging	0.96
R6660:Slc4a10	UTSW	2	62250403	missense	possibly damaging	0.55
R7008:Slc4a10	UTSW	2	62286922	missense	probably benign	0.00
R7083:Slc4a10	UTSW	2	62234495	missense	probably benign	0.03
R7223:Slc4a10	UTSW	2	62268665	missense	probably damaging	0.99
R7243:Slc4a10	UTSW	2	62303862	missense	probably damaging	1.00
R7449:Slc4a10	UTSW	2	62303946	missense	probably benign
R7621:Slc4a10	UTSW	2	62250479	missense	probably damaging	0.98
R7692:Slc4a10	UTSW	2	62303964	missense	possibly damaging	0.94
R7742:Slc4a10	UTSW	2	62296850	missense	probably damaging	1.00
R7905:Slc4a10	UTSW	2	62268151	missense	probably damaging	1.00
R8179:Slc4a10	UTSW	2	62243448	missense	possibly damaging	0.64
R8528:Slc4a10	UTSW	2	62296796	missense	possibly damaging	0.79
R8531:Slc4a10	UTSW	2	62267507	missense	probably damaging	1.00
R8772:Slc4a10	UTSW	2	62303940	missense	probably damaging	1.00
R9307:Slc4a10	UTSW	2	62253318	missense	probably damaging	1.00
R9531:Slc4a10	UTSW	2	62268810	missense	probably damaging	1.00
R9732:Slc4a10	UTSW	2	62304742	missense	probably damaging	0.97
U24488:Slc4a10	UTSW	2	62046658	missense	probably benign	0.05
X0019:Slc4a10	UTSW	2	62228599	missense	probably damaging	1.00
Z1088:Slc4a10	UTSW	2	62228571	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62211379	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62244416	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGCAAAAGTTGGTTGGTGC -3'
(R):5'- GAAGACACTGAGAAGCATAATGC -3'

Sequencing Primer
(F):5'- TGTAGACATCTTGAACACGCAG -3'
(R):5'- GCTTGTAAAAATTGTCATTCTCCC -3'

Posted On

2014-06-23