Incidental Mutation 'R1848:Loxhd1'
ID 207963
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Name lipoxygenase homology domains 1
Synonyms 1700096C21Rik, sba
MMRRC Submission 039873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.183) question?
Stock # R1848 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 77369654-77530626 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77369667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 5 (K5R)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096547]
AlphaFold C8YR32
Predicted Effect possibly damaging
Transcript: ENSMUST00000096547
AA Change: K5R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: K5R

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 88,295,121 (GRCm39) Y86* probably null Het
Aadac A G 3: 59,947,118 (GRCm39) E272G probably damaging Het
Abcc8 A T 7: 45,816,326 (GRCm39) D271E probably benign Het
Acan T C 7: 78,748,783 (GRCm39) F1185L probably benign Het
Adam1a A T 5: 121,657,683 (GRCm39) C537S probably damaging Het
Ago2 A G 15: 72,995,814 (GRCm39) V395A probably benign Het
Alox15 A G 11: 70,241,578 (GRCm39) V101A probably damaging Het
Ankra2 T C 13: 98,407,632 (GRCm39) I194T probably damaging Het
Apobec4 C A 1: 152,631,981 (GRCm39) P3H probably damaging Het
Arid3b G T 9: 57,703,960 (GRCm39) Y329* probably null Het
Atm A T 9: 53,379,312 (GRCm39) S1993T probably benign Het
Bpgm T G 6: 34,464,669 (GRCm39) S129A probably benign Het
Brat1 A G 5: 140,704,264 (GRCm39) D839G possibly damaging Het
Ccdc15 A T 9: 37,253,866 (GRCm39) S128T probably benign Het
Cd300lg A T 11: 101,937,032 (GRCm39) probably benign Het
Cdc34b C A 11: 94,633,303 (GRCm39) Q168K probably damaging Het
Celsr2 A T 3: 108,308,626 (GRCm39) V1767E probably benign Het
Cep350 T C 1: 155,829,397 (GRCm39) D169G probably benign Het
Col7a1 A T 9: 108,798,633 (GRCm39) D1762V possibly damaging Het
Coro7 A G 16: 4,448,298 (GRCm39) L724P probably damaging Het
Crb1 T A 1: 139,164,750 (GRCm39) I1125F probably damaging Het
Ctif T A 18: 75,653,012 (GRCm39) D415V probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dhrs2 A G 14: 55,478,298 (GRCm39) D237G probably benign Het
Dhx9 T C 1: 153,341,499 (GRCm39) Q582R probably damaging Het
Dnajc1 C T 2: 18,224,524 (GRCm39) R443Q probably damaging Het
Dnm2 C T 9: 21,416,977 (GRCm39) R837W possibly damaging Het
Dpf2 C A 19: 5,956,643 (GRCm39) Q70H probably damaging Het
Dqx1 T A 6: 83,043,088 (GRCm39) D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 (GRCm39) T3245S probably benign Het
Ect2l A G 10: 18,075,781 (GRCm39) L35P probably damaging Het
Efcab5 A T 11: 76,994,132 (GRCm39) L1285Q probably damaging Het
Eif4g1 G C 16: 20,500,617 (GRCm39) R697P probably damaging Het
Emsy T A 7: 98,250,028 (GRCm39) E753V probably damaging Het
Entpd3 A G 9: 120,387,485 (GRCm39) I227M probably damaging Het
Epn1 T A 7: 5,092,997 (GRCm39) V103E probably damaging Het
Esrra T C 19: 6,889,378 (GRCm39) D337G probably benign Het
Fam83e A T 7: 45,378,193 (GRCm39) K406* probably null Het
Fam83e A T 7: 45,378,194 (GRCm39) K406M possibly damaging Het
Fat2 A G 11: 55,202,384 (GRCm39) I230T probably damaging Het
Fbxl16 A G 17: 26,035,420 (GRCm39) I6V probably benign Het
Fgf23 T C 6: 127,050,156 (GRCm39) I55T probably damaging Het
Fibcd1 T A 2: 31,711,561 (GRCm39) D288V probably damaging Het
Flnb T C 14: 7,892,113 (GRCm38) I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 (GRCm39) E449G probably benign Het
Gbf1 T G 19: 46,260,476 (GRCm39) S1130A possibly damaging Het
Gipc3 T C 10: 81,177,099 (GRCm39) E157G probably damaging Het
Glra3 G T 8: 56,393,942 (GRCm39) A18S probably benign Het
Gm6625 A C 8: 89,873,462 (GRCm39) noncoding transcript Het
Gpx4 A G 10: 79,891,870 (GRCm39) probably benign Het
Grb10 A G 11: 11,896,029 (GRCm39) F264L possibly damaging Het
Grik3 T C 4: 125,587,931 (GRCm39) Y684H probably damaging Het
Gstp1 C T 19: 4,086,795 (GRCm39) probably benign Het
H2bc27 A T 11: 58,839,928 (GRCm39) I55F possibly damaging Het
Haus8 G A 8: 71,708,767 (GRCm39) probably benign Het
Hip1 G A 5: 135,463,995 (GRCm39) probably null Het
Hspbap1 T A 16: 35,639,134 (GRCm39) probably null Het
Htr2b T A 1: 86,027,151 (GRCm39) I452F possibly damaging Het
Hydin T A 8: 111,296,440 (GRCm39) H3656Q probably benign Het
Klb T A 5: 65,506,180 (GRCm39) D142E probably benign Het
Lamb3 A T 1: 193,016,924 (GRCm39) T777S possibly damaging Het
Lins1 C A 7: 66,364,070 (GRCm39) T650K probably damaging Het
Lpp G A 16: 24,580,405 (GRCm39) M40I probably damaging Het
Mia2 A T 12: 59,217,037 (GRCm39) probably benign Het
Miip A C 4: 147,947,549 (GRCm39) F204V probably damaging Het
Mmp21 T C 7: 133,278,882 (GRCm39) R323G probably benign Het
Mta3 T A 17: 84,062,980 (GRCm39) probably benign Het
Myh1 A G 11: 67,104,456 (GRCm39) K1004R probably benign Het
Myh14 T A 7: 44,281,853 (GRCm39) I810F probably damaging Het
Nbas A C 12: 13,463,598 (GRCm39) D1295A probably damaging Het
Niban3 T C 8: 72,056,413 (GRCm39) M371T possibly damaging Het
Npr2 T G 4: 43,632,384 (GRCm39) V67G probably benign Het
Oas1f C A 5: 120,993,492 (GRCm39) Q235K probably damaging Het
Or12d17 T A 17: 37,777,938 (GRCm39) S280R probably damaging Het
Or13a27 T A 7: 139,925,900 (GRCm39) M1L probably benign Het
Or1p1 G T 11: 74,180,039 (GRCm39) C189F probably damaging Het
Or52ae9 T C 7: 103,390,381 (GRCm39) N22S probably benign Het
Or7e166 C T 9: 19,624,386 (GRCm39) H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,152,852 (GRCm39) probably null Het
Pde1b A G 15: 103,433,767 (GRCm39) probably null Het
Pdilt T C 7: 119,088,607 (GRCm39) T465A probably benign Het
Plxnd1 T C 6: 115,943,507 (GRCm39) H1233R probably damaging Het
Ppm1b T A 17: 85,301,552 (GRCm39) M144K probably benign Het
Prkdc T C 16: 15,625,922 (GRCm39) L3316S probably benign Het
Prm2 T A 16: 10,609,455 (GRCm39) probably benign Het
Prmt7 T C 8: 106,963,640 (GRCm39) V240A probably benign Het
Prx C A 7: 27,218,313 (GRCm39) A938E possibly damaging Het
Rbm7 A G 9: 48,402,194 (GRCm39) V131A probably benign Het
Ric1 T A 19: 29,578,213 (GRCm39) probably null Het
Rnf150 A T 8: 83,590,639 (GRCm39) M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 (GRCm39) R298W probably damaging Het
Rp1 T A 1: 4,417,455 (GRCm39) Y1219F possibly damaging Het
Scn7a A G 2: 66,514,357 (GRCm39) probably null Het
Sdad1 A G 5: 92,440,510 (GRCm39) probably null Het
Septin9 T C 11: 117,243,909 (GRCm39) probably benign Het
Serinc3 T C 2: 163,487,409 (GRCm39) probably benign Het
Shc3 C T 13: 51,615,424 (GRCm39) G178R probably damaging Het
Slc4a10 A T 2: 62,146,950 (GRCm39) K1090M probably damaging Het
Slco1a1 T C 6: 141,868,837 (GRCm39) I376V probably benign Het
Slmap A T 14: 26,143,729 (GRCm39) F719L probably benign Het
Smgc A G 15: 91,743,956 (GRCm39) N573D possibly damaging Het
Spx G A 6: 142,359,805 (GRCm39) probably null Het
Srrt C G 5: 137,295,207 (GRCm39) E308Q probably damaging Het
Tas2r130 T A 6: 131,607,560 (GRCm39) R78S probably benign Het
Tchhl1 A G 3: 93,378,408 (GRCm39) R371G probably damaging Het
Teddm2 C T 1: 153,726,194 (GRCm39) A174T probably benign Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Trim33 T C 3: 103,231,956 (GRCm39) probably benign Het
Tspan31 A G 10: 126,905,327 (GRCm39) V40A probably damaging Het
Uevld A G 7: 46,594,975 (GRCm39) probably benign Het
Vcl G T 14: 21,059,063 (GRCm39) A560S probably benign Het
Vmn2r24 T A 6: 123,793,183 (GRCm39) C837S probably damaging Het
Vmn2r57 C T 7: 41,077,531 (GRCm39) V212M probably damaging Het
Vps13c A G 9: 67,843,622 (GRCm39) T1968A probably benign Het
Vtn A G 11: 78,391,393 (GRCm39) R269G probably damaging Het
Wdcp G A 12: 4,900,245 (GRCm39) V34I possibly damaging Het
Zc3h14 A G 12: 98,719,091 (GRCm39) D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 (GRCm39) P123L probably benign Het
Zfp318 T C 17: 46,716,981 (GRCm39) S1038P possibly damaging Het
Zfp873 A G 10: 81,896,406 (GRCm39) D416G probably benign Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77,483,146 (GRCm39) missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77,518,770 (GRCm39) missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77,420,263 (GRCm39) missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77,493,672 (GRCm39) missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77,416,897 (GRCm39) missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77,374,120 (GRCm39) missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77,427,797 (GRCm39) missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77,456,833 (GRCm39) missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77,490,648 (GRCm39) missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77,498,235 (GRCm39) missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77,493,628 (GRCm39) missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77,444,609 (GRCm39) missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77,456,811 (GRCm39) splice site probably benign
IGL03032:Loxhd1 APN 18 77,374,169 (GRCm39) missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77,529,480 (GRCm39) missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77,518,809 (GRCm39) missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77,468,160 (GRCm39) missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77,496,446 (GRCm39) missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77,529,369 (GRCm39) missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77,429,627 (GRCm39) missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77,529,464 (GRCm39) missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77,496,474 (GRCm39) missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77,456,833 (GRCm39) missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77,471,526 (GRCm39) splice site probably null
R0367:Loxhd1 UTSW 18 77,513,453 (GRCm39) splice site probably benign
R0709:Loxhd1 UTSW 18 77,492,665 (GRCm39) missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77,517,680 (GRCm39) missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77,517,639 (GRCm39) missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77,493,699 (GRCm39) critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77,490,632 (GRCm39) missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1501:Loxhd1 UTSW 18 77,444,528 (GRCm39) missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77,490,259 (GRCm39) missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77,409,364 (GRCm39) missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77,492,498 (GRCm39) missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77,380,937 (GRCm39) missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77,492,585 (GRCm39) missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77,513,335 (GRCm39) missense possibly damaging 0.88
R1796:Loxhd1 UTSW 18 77,493,603 (GRCm39) missense probably damaging 0.96
R1800:Loxhd1 UTSW 18 77,490,198 (GRCm39) missense probably damaging 1.00
R1912:Loxhd1 UTSW 18 77,427,833 (GRCm39) missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77,492,504 (GRCm39) missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77,409,338 (GRCm39) missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77,383,465 (GRCm39) missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77,472,642 (GRCm39) missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77,443,862 (GRCm39) missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77,518,774 (GRCm39) missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77,469,719 (GRCm39) missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77,496,464 (GRCm39) missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77,501,855 (GRCm39) missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77,418,755 (GRCm39) missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77,486,697 (GRCm39) missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77,483,123 (GRCm39) missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77,460,607 (GRCm39) missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77,529,456 (GRCm39) missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77,518,828 (GRCm39) missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77,486,785 (GRCm39) missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77,444,608 (GRCm39) missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77,493,642 (GRCm39) missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77,490,581 (GRCm39) missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77,459,987 (GRCm39) missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77,483,153 (GRCm39) missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77,472,663 (GRCm39) missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77,449,432 (GRCm39) missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77,451,308 (GRCm39) missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77,498,268 (GRCm39) missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77,420,378 (GRCm39) missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77,454,237 (GRCm39) missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77,429,751 (GRCm39) missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77,492,647 (GRCm39) missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77,444,573 (GRCm39) missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77,374,105 (GRCm39) missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77,490,211 (GRCm39) missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77,499,946 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77,383,454 (GRCm39) missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77,499,874 (GRCm39) missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77,449,426 (GRCm39) missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77,468,128 (GRCm39) missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77,499,847 (GRCm39) missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77,380,965 (GRCm39) missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77,518,873 (GRCm39) missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77,529,222 (GRCm39) missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77,460,129 (GRCm39) critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77,476,210 (GRCm39) missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77,501,892 (GRCm39) missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77,529,513 (GRCm39) missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77,420,338 (GRCm39) missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77,383,547 (GRCm39) missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77,500,001 (GRCm39) missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77,483,061 (GRCm39) missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77,409,330 (GRCm39) missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77,517,671 (GRCm39) missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77,518,882 (GRCm39) missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77,472,637 (GRCm39) missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77,471,425 (GRCm39) missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77,496,483 (GRCm39) missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77,518,909 (GRCm39) missense probably damaging 0.98
R7960:Loxhd1 UTSW 18 77,472,746 (GRCm39) missense probably damaging 0.99
R7986:Loxhd1 UTSW 18 77,462,890 (GRCm39) missense possibly damaging 0.88
R8042:Loxhd1 UTSW 18 77,518,888 (GRCm39) missense probably damaging 0.99
R8084:Loxhd1 UTSW 18 77,427,845 (GRCm39) missense possibly damaging 0.71
R8088:Loxhd1 UTSW 18 77,429,709 (GRCm39) missense possibly damaging 0.52
R8100:Loxhd1 UTSW 18 77,492,512 (GRCm39) missense possibly damaging 0.69
R8139:Loxhd1 UTSW 18 77,468,192 (GRCm39) missense possibly damaging 0.95
R8152:Loxhd1 UTSW 18 77,476,095 (GRCm39) missense possibly damaging 0.62
R8199:Loxhd1 UTSW 18 77,469,334 (GRCm39) missense possibly damaging 0.77
R8246:Loxhd1 UTSW 18 77,451,242 (GRCm39) missense possibly damaging 0.71
R8263:Loxhd1 UTSW 18 77,462,858 (GRCm39) missense probably damaging 1.00
R8324:Loxhd1 UTSW 18 77,427,275 (GRCm39) critical splice donor site probably null
R8342:Loxhd1 UTSW 18 77,493,681 (GRCm39) missense possibly damaging 0.88
R8401:Loxhd1 UTSW 18 77,468,156 (GRCm39) missense probably damaging 1.00
R8480:Loxhd1 UTSW 18 77,518,827 (GRCm39) missense probably damaging 1.00
R8490:Loxhd1 UTSW 18 77,529,162 (GRCm39) missense possibly damaging 0.96
R8807:Loxhd1 UTSW 18 77,444,468 (GRCm39) missense possibly damaging 0.93
R8961:Loxhd1 UTSW 18 77,472,765 (GRCm39) missense probably damaging 1.00
R8974:Loxhd1 UTSW 18 77,518,899 (GRCm39) missense possibly damaging 0.88
R9079:Loxhd1 UTSW 18 77,490,593 (GRCm39) missense probably benign
R9284:Loxhd1 UTSW 18 77,501,826 (GRCm39) missense probably damaging 0.97
R9312:Loxhd1 UTSW 18 77,498,285 (GRCm39) missense probably benign 0.05
R9619:Loxhd1 UTSW 18 77,443,871 (GRCm39) missense probably benign 0.32
X0020:Loxhd1 UTSW 18 77,427,258 (GRCm39) nonsense probably null
X0024:Loxhd1 UTSW 18 77,483,099 (GRCm39) missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77,529,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACTTTGGGATTGGGGAC -3'
(R):5'- TGCAAAGCTCTCCTCAGAAG -3'

Sequencing Primer
(F):5'- GACCCAGGAGACCCAGG -3'
(R):5'- GACAGATTCCGCAGCCC -3'
Posted On 2014-06-23